Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJB9 cdna clone

DNAJB9 cDNA Clone

Gene Names
DNAJB9; MDG1; ERdj4; MDG-1; MST049; MSTP049
Synonyms
DNAJB9; DNAJB9 cDNA Clone; DNAJB9 cdna clone
Ordering
For Research Use Only!
Sequence
atggctactccccagtcaattttcatctttgcaatctgcattttaatgataacagaattaattctggcctcaaaaagctactatgatatcttaggtgtgccaaaatcggcatcagagcgccaaatcaagaaggcctttcacaagttggccatgaagtaccaccctgacaaaaataagagcccggatgctgaagcaaaattcagagagattgcagaagcatatgaaacactctcagatgctaatagacgaaaagagtatgatacacttggacacagtgcttttactagtggtaaaggacaaagaggtagtggaagttcttttgagcagtcatttaacttcaattttgatgacttatttaaagactttggcttttttggtcaaaaccaaaacactggatccaagaagcgttttgaaaatcatttccagacacgccaggatggtggttccagtagacaaaggcatcatttccaagaattttcttttggaggtggattatttgatgacatgtttgaagatatggagaaaatgttttcttttagtggttttgactctaccaatcagcatacagtacagactgaaaatagatttcatggatctagcaagcactgcaggactgtcactcaacgaagaggaaatatggttactacatacactgactgttcaggacagtag
Sequence Length
672
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,518 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily B, member 9, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member B9
NCBI Official Symbol
DNAJB9
NCBI Official Synonym Symbols
MDG1; ERdj4; MDG-1; MST049; MSTP049
NCBI Protein Information
dnaJ homolog subfamily B member 9
UniProt Protein Name
DnaJ homolog subfamily B member 9
Protein Family
UniProt Gene Name
DNAJB9
UniProt Synonym Gene Names
MDG1; ER-resident protein ERdj4; ERdj4; Mdg-1
UniProt Entry Name
DNJB9_HUMAN

NCBI Description

This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. This gene is a member of the type 2 subgroup of DnaJ proteins. The encoded protein is localized to the endoplasmic reticulum. This protein is induced by endoplasmic reticulum stress and plays a role in protecting stressed cells from apoptosis. [provided by RefSeq, Dec 2010]

Uniprot Description

DNAJB9: Acts as a co-chaperone with an Hsp70 protein.

Protein type: Endoplasmic reticulum; Chaperone

Chromosomal Location of Human Ortholog: 7q31|14q24.2-q24.3

Cellular Component: cytoplasm; endoplasmic reticulum; endoplasmic reticulum membrane; nucleolus

Molecular Function: misfolded protein binding; protein binding

Biological Process: ER-associated protein catabolic process

Research Articles on DNAJB9

Similar Products

Product Notes

The DNAJB9 dnajb9 (Catalog #AAA1273823) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctactc cccagtcaat tttcatcttt gcaatctgca ttttaatgat aacagaatta attctggcct caaaaagcta ctatgatatc ttaggtgtgc caaaatcggc atcagagcgc caaatcaaga aggcctttca caagttggcc atgaagtacc accctgacaa aaataagagc ccggatgctg aagcaaaatt cagagagatt gcagaagcat atgaaacact ctcagatgct aatagacgaa aagagtatga tacacttgga cacagtgctt ttactagtgg taaaggacaa agaggtagtg gaagttcttt tgagcagtca tttaacttca attttgatga cttatttaaa gactttggct tttttggtca aaaccaaaac actggatcca agaagcgttt tgaaaatcat ttccagacac gccaggatgg tggttccagt agacaaaggc atcatttcca agaattttct tttggaggtg gattatttga tgacatgttt gaagatatgg agaaaatgtt ttcttttagt ggttttgact ctaccaatca gcatacagta cagactgaaa atagatttca tggatctagc aagcactgca ggactgtcac tcaacgaaga ggaaatatgg ttactacata cactgactgt tcaggacagt ag. It is sometimes possible for the material contained within the vial of "DNAJB9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.