Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJB4 cdna clone

DNAJB4 cDNA Clone

Gene Names
DNAJB4; DjB4; HLJ1; DNAJW
Synonyms
DNAJB4; DNAJB4 cDNA Clone; DNAJB4 cdna clone
Ordering
For Research Use Only!
Sequence
atggggaaagactattattgcattttgggaattgagaaaggagcttcagatgaagatattaaaaaggcttaccgaaaacaagccctcaaatttcatccggacaagaacaaatctcctcaggcagaggaaaaatttaaagaggtcgcagaagcttatgaagtattgagtgatcctaaaaagagagaaatatatgatcagtttggggaggaagggttgaaaggaggagcaggaggtactgatggacaaggaggtaccttccggtacacctttcatggcgatcctcatgctacatttgctgcatttttcggagggtccaacccctttgaaattttctttggaagacgaatgggtggtggtagagattctgaagaaatggaaatagatggtgatccttttagtgcctttggtttcagcatgaatggatatccaagagacaggaattctgtggggccatcccgcctcaaacaagatcctccagttattcatgaacttagagtatcacttgaagagatatatagtggttgtaccaaacggatgaagatttctcgaaaaaggctaaacgctgatggaaggagttacagatctgaggacaaaattcttaccattgagattaaaaaagggtggaaagaaggcaccaaaattacttttccaagagaaggagatgaaacaccaaatagtattccagcagacattgtttttatcattaaagacaaagatcatccaaaatttaaaagggatggatcaaatataatttatactgctaaaattagtttacgagaggcattgtgtggctgctcaattaatgtaccaacactggatggaagaaacatacctatgtcagtaaatgatattgtgaaacccggaatgaggagaagaattattggatatgggctgccatttccaaaaaatcctgaccaacgtggtgaccttctaatagaatttgaggtgtccttcccagatactatatcttcttcatccaaagaagtacttaggaaacatcttcctgcctcatag
Sequence Length
1014
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,807 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily B, member 4, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member B4
NCBI Official Symbol
DNAJB4
NCBI Official Synonym Symbols
DjB4; HLJ1; DNAJW
NCBI Protein Information
dnaJ homolog subfamily B member 4
UniProt Protein Name
DnaJ homolog subfamily B member 4
Protein Family
UniProt Gene Name
DNAJB4
UniProt Synonym Gene Names
DNAJW; HLJ1; HSP40 homolog; Heat shock protein 40 homolog
UniProt Entry Name
DNJB4_HUMAN

NCBI Description

The protein encoded by this gene is a molecular chaperone, tumor suppressor, and member of the heat shock protein-40 family. The encoded protein binds the cell adhesion protein E-cadherin and targets it to the plasma membrane. This protein also binds incorrectly folded E-cadherin and targets it for endoplasmic reticulum-associated degradation. This gene is a strong tumor suppressor for colorectal carcinoma, and downregulation of it may serve as a good biomarker for predicting patient outcomes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Uniprot Description

DNAJB4: Probable chaperone. Homodimer. The C-terminal section interacts with the C- terminal tail of OPRM1. Interacts also with SDIM1. By heat shock. Expressed in heart, pancreas and skeletal muscle, and to a lesser extent in brain, placenta and liver.

Protein type: Chaperone

Chromosomal Location of Human Ortholog: 1p31.1

Cellular Component: cytoplasm; cytosol; nucleoplasm; plasma membrane

Molecular Function: chaperone binding; protein binding

Biological Process: response to heat; response to unfolded protein

Research Articles on DNAJB4

Similar Products

Product Notes

The DNAJB4 dnajb4 (Catalog #AAA1278642) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaaag actattattg cattttggga attgagaaag gagcttcaga tgaagatatt aaaaaggctt accgaaaaca agccctcaaa tttcatccgg acaagaacaa atctcctcag gcagaggaaa aatttaaaga ggtcgcagaa gcttatgaag tattgagtga tcctaaaaag agagaaatat atgatcagtt tggggaggaa gggttgaaag gaggagcagg aggtactgat ggacaaggag gtaccttccg gtacaccttt catggcgatc ctcatgctac atttgctgca tttttcggag ggtccaaccc ctttgaaatt ttctttggaa gacgaatggg tggtggtaga gattctgaag aaatggaaat agatggtgat ccttttagtg cctttggttt cagcatgaat ggatatccaa gagacaggaa ttctgtgggg ccatcccgcc tcaaacaaga tcctccagtt attcatgaac ttagagtatc acttgaagag atatatagtg gttgtaccaa acggatgaag atttctcgaa aaaggctaaa cgctgatgga aggagttaca gatctgagga caaaattctt accattgaga ttaaaaaagg gtggaaagaa ggcaccaaaa ttacttttcc aagagaagga gatgaaacac caaatagtat tccagcagac attgttttta tcattaaaga caaagatcat ccaaaattta aaagggatgg atcaaatata atttatactg ctaaaattag tttacgagag gcattgtgtg gctgctcaat taatgtacca acactggatg gaagaaacat acctatgtca gtaaatgata ttgtgaaacc cggaatgagg agaagaatta ttggatatgg gctgccattt ccaaaaaatc ctgaccaacg tggtgacctt ctaatagaat ttgaggtgtc cttcccagat actatatctt cttcatccaa agaagtactt aggaaacatc ttcctgcctc atag. It is sometimes possible for the material contained within the vial of "DNAJB4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.