Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJB11 cdna clone

DNAJB11 cDNA Clone

Gene Names
DNAJB11; DJ9; EDJ; Dj-9; ERj3; ABBP2; ERdj3; ERj3p; ABBP-2; UNQ537; PRO1080
Synonyms
DNAJB11; DNAJB11 cDNA Clone; DNAJB11 cdna clone
Ordering
For Research Use Only!
Sequence
atggctccgcagaacctgagcaccttttgcctgttgctgctatacctcatcggggcggtgattgccggacgagatttctataagatcttgggggtgcctcgaagtgcctctataaaggatattaaaaaggcctataggaaactagccctgcagcttcatcccgaccggaaccctgatgatccacaagcccaggagaaattccaggatctgggtgctgcttatgaggttctgtcagatagtgagaaacggaaacagtacgatacttatggtgaagaaggattaaaagatggtcatcagagctcccatggagacattttttcacacttctttggggattttggtttcatgtttggaggaacccctcgtcagcaagacagaaatattccaagaggaagtgatattattgtagatctagaagtcactttggaagaagtatatgcaggaaattttgtggaagtagttagaaacaaacctgtggcaaggcaggctcctggcaaacggaagtgcaattgtcggcaagagatgcggaccacccagctgggccctgggcgcttccaaatgacccaggaggtggtctgcgacgaatgccctaatgtcaaactagtgaatgaagaacgaacgctggaagtagaaatagagcctggggtgagagacggcatggagtacccctttattggagaaggtgagcctcacgtggatggggagcctggagatttacggttccgaatcaaagttgtcaagcacccaatatttgaaaggagaggagatgatttgtacacaaatgtgacaatctcattagttgagtcactggttggctttgagatggatattactcacttggatggtcacaaggtacatatttcccgggataagatcaccaggccaggagcgaagctatggaagaaaggggaagggctccccaactttgacaacaacaatatcaagggctctttgataatcacttttgatgtggattttccaaaagaacagttaacagaggaagcgagagaaggtatcaaacagctactgaaacaagggtcagtgcagaaggtatacaatggactgcaaggatattga
Sequence Length
1077
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,514 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily B, member 11, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member B11
NCBI Official Symbol
DNAJB11
NCBI Official Synonym Symbols
DJ9; EDJ; Dj-9; ERj3; ABBP2; ERdj3; ERj3p; ABBP-2; UNQ537; PRO1080
NCBI Protein Information
dnaJ homolog subfamily B member 11
UniProt Protein Name
DnaJ homolog subfamily B member 11
Protein Family
UniProt Gene Name
DNAJB11
UniProt Synonym Gene Names
EDJ; ERJ3; HDJ9; ABBP-2; ER-resident protein ERdj3; ERdj3; ERj3p; hDj-9
UniProt Entry Name
DJB11_HUMAN

NCBI Description

This gene encodes a soluble glycoprotein of the endoplasmic reticulum (ER) lumen that functions as a co-chaperone of binding immunoglobulin protein, a 70 kilodalton heat shock protein chaperone required for the proper folding and assembly of proteins in the ER. The encoded protein contains a highly conserved J domain of about 70 amino acids with a characteristic His-Pro-Asp (HPD) motif and may regulate the activity of binding immunoglobulin protein by stimulating ATPase activity. [provided by RefSeq, Mar 2014]

Uniprot Description

DNAJB11: Serves as a co-chaperone for HSPA5. Binds directly to both unfolded proteins that are substrates for ERAD and nascent unfolded peptide chains, but dissociates from the HSPA5-unfolded protein complex before folding is completed. May help recruiting HSPA5 and other chaperones to the substrate. Stimulates HSPA5 ATPase activity.

Protein type: Secreted, signal peptide; RNA processing; Endoplasmic reticulum; Secreted; Chaperone

Chromosomal Location of Human Ortholog: 3q27.3

Cellular Component: endoplasmic reticulum; endoplasmic reticulum lumen; membrane

Molecular Function: protein binding

Biological Process: positive regulation of ATPase activity

Research Articles on DNAJB11

Similar Products

Product Notes

The DNAJB11 dnajb11 (Catalog #AAA1273209) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctccgc agaacctgag caccttttgc ctgttgctgc tatacctcat cggggcggtg attgccggac gagatttcta taagatcttg ggggtgcctc gaagtgcctc tataaaggat attaaaaagg cctataggaa actagccctg cagcttcatc ccgaccggaa ccctgatgat ccacaagccc aggagaaatt ccaggatctg ggtgctgctt atgaggttct gtcagatagt gagaaacgga aacagtacga tacttatggt gaagaaggat taaaagatgg tcatcagagc tcccatggag acattttttc acacttcttt ggggattttg gtttcatgtt tggaggaacc cctcgtcagc aagacagaaa tattccaaga ggaagtgata ttattgtaga tctagaagtc actttggaag aagtatatgc aggaaatttt gtggaagtag ttagaaacaa acctgtggca aggcaggctc ctggcaaacg gaagtgcaat tgtcggcaag agatgcggac cacccagctg ggccctgggc gcttccaaat gacccaggag gtggtctgcg acgaatgccc taatgtcaaa ctagtgaatg aagaacgaac gctggaagta gaaatagagc ctggggtgag agacggcatg gagtacccct ttattggaga aggtgagcct cacgtggatg gggagcctgg agatttacgg ttccgaatca aagttgtcaa gcacccaata tttgaaagga gaggagatga tttgtacaca aatgtgacaa tctcattagt tgagtcactg gttggctttg agatggatat tactcacttg gatggtcaca aggtacatat ttcccgggat aagatcacca ggccaggagc gaagctatgg aagaaagggg aagggctccc caactttgac aacaacaata tcaagggctc tttgataatc acttttgatg tggattttcc aaaagaacag ttaacagagg aagcgagaga aggtatcaaa cagctactga aacaagggtc agtgcagaag gtatacaatg gactgcaagg atattga. It is sometimes possible for the material contained within the vial of "DNAJB11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.