DNAJA4 cdna clone
DNAJA4 cDNA Clone
Gene Names
DNAJA4; MST104; MSTP104; PRO1472
Synonyms
DNAJA4; DNAJA4 cDNA Clone; DNAJA4 cdna clone
Sequence
atggtgaaggagacccagtactatgacatcctgggcgtgaagcccagcgcgtccccggaggagatcaagaaggcctatcggaagctggcgctcaagtaccacccggacaagaacccggatgagggcgagaagtttaaactcatatcccaggcatatgaagtgctttcagatccaaagaaaagggatgtttatgaccaaggcggagagcaggcaattaaagaaggaggctcaggcagccccagcttctcttcacccatggacatctttgacatgttctttggtggtggtggacggatggctagagagagaagaggcaagaatgttgtacaccagttatctgtaactcttgaagatttatataatggagtcacgaagaaattggccctccagaaaaatgtaatttgtgagaaatgtgaaggtgttggtgggaagaagggatcggtggagaagtgcccgctgtgcaaggggcgggggatgcagatccacatccagcagatcgggccgggcatggtacagcagatccagaccgtgtgcatcgagtgcaagggccagggtgagcgcatcaaccccaaggaccgctgcgagagctgcagcggggccaaggtgatccgtgagaagaagattatcgaggtacatgttgaaaaaggtatgaaagatgggcaaaagatactatttcatggagaaggagatcaggagcctgagctggagcctggtgatgtcataattgtgcttgatcagaaggatcatagtgtctttcagagacgaggccatgacttgatcatgaaaatgaaaattcagctttctgaagctctttgtggcttcaagaagacgataaaaacattggacaatcgaattcttgttattacatccaaagcaggtgaggtgataaagcacggggacctgagatgcgtgcgcgatgaaggaatgcccatctacaaagcacccctggaaaaagggattctgatcatacagtttttagtaatctttcctgaaaaacactggctttctctggaaaagcttcctcagctggaagctttactccctcctcgacagaaagtgaggattacagatgacatggatcaggtggagctgaaggagttttgtcccaatgagcagaactggcgtcagcacagggaggcctacgaggaggacgaagacgggccccaggctggagtgcagtgccagacggcatga
Sequence Length
1194
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
41,597 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily A, member 4, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member A4
NCBI Official Symbol
DNAJA4
NCBI Official Synonym Symbols
MST104; MSTP104; PRO1472
NCBI Protein Information
dnaJ homolog subfamily A member 4
UniProt Protein Name
DnaJ homolog subfamily A member 4
Protein Family
UniProt Gene Name
DNAJA4
UniProt Entry Name
DNJA4_HUMAN
Uniprot Description
DNAJA4: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Chaperone
Chromosomal Location of Human Ortholog: 15q25.1
Cellular Component: cytosol; membrane
Molecular Function: chaperone binding; protein binding; unfolded protein binding
Biological Process: protein refolding
Similar Products
Product Notes
The DNAJA4 dnaja4 (Catalog #AAA1267014) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgaagg agacccagta ctatgacatc ctgggcgtga agcccagcgc gtccccggag gagatcaaga aggcctatcg gaagctggcg ctcaagtacc acccggacaa gaacccggat gagggcgaga agtttaaact catatcccag gcatatgaag tgctttcaga tccaaagaaa agggatgttt atgaccaagg cggagagcag gcaattaaag aaggaggctc aggcagcccc agcttctctt cacccatgga catctttgac atgttctttg gtggtggtgg acggatggct agagagagaa gaggcaagaa tgttgtacac cagttatctg taactcttga agatttatat aatggagtca cgaagaaatt ggccctccag aaaaatgtaa tttgtgagaa atgtgaaggt gttggtggga agaagggatc ggtggagaag tgcccgctgt gcaaggggcg ggggatgcag atccacatcc agcagatcgg gccgggcatg gtacagcaga tccagaccgt gtgcatcgag tgcaagggcc agggtgagcg catcaacccc aaggaccgct gcgagagctg cagcggggcc aaggtgatcc gtgagaagaa gattatcgag gtacatgttg aaaaaggtat gaaagatggg caaaagatac tatttcatgg agaaggagat caggagcctg agctggagcc tggtgatgtc ataattgtgc ttgatcagaa ggatcatagt gtctttcaga gacgaggcca tgacttgatc atgaaaatga aaattcagct ttctgaagct ctttgtggct tcaagaagac gataaaaaca ttggacaatc gaattcttgt tattacatcc aaagcaggtg aggtgataaa gcacggggac ctgagatgcg tgcgcgatga aggaatgccc atctacaaag cacccctgga aaaagggatt ctgatcatac agtttttagt aatctttcct gaaaaacact ggctttctct ggaaaagctt cctcagctgg aagctttact ccctcctcga cagaaagtga ggattacaga tgacatggat caggtggagc tgaaggagtt ttgtcccaat gagcagaact ggcgtcagca cagggaggcc tacgaggagg acgaagacgg gccccaggct ggagtgcagt gccagacggc atga. It is sometimes possible for the material contained within the vial of "DNAJA4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
