Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DLK1 cdna clone

DLK1 cDNA Clone

Gene Names
DLK1; DLK; FA1; ZOG; pG2; DLK-1; PREF1; Delta1; Pref-1
Synonyms
DLK1; DLK1 cDNA Clone; DLK1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccgcgaccgaagccctcctgcgcgtcctcttgctcctgctggctttcggccacagcacctatggggctgaatgcttcccggcctgcaacccccaaaatggattctgcgaggatgacaatgtttgcaggtgccagcctggctggcagggtcccctttgtgaccagtgcgtgacctctcccggctgccttcacggactctgtggagaacccgggcagtgcatttgcaccgacggctgggacggggagctctgtgatagagatgttcgggcctgctcctcggccccctgtgccaacaacgggacctgcgtgagcctggacgatggcctctatgaatgctcctgtgcccccgggtactcgggaaaggactgccagaaaaaggacgggccctgtgtgatcaacggctccccctgccagcacggaggcacctgcgtggatgatgagggccgggcctcccatgcctcctgcctgtgcccccctggcttctcaggcaatttctgcgagatcgtggccaacagctgcacccccaacccatgcgagaacgacggcgtctgcactgacatcgggggcgacttccgctgccggtgcccagccggcttcatcgacaagacctgcagccgcccggtgaccaactgcgccagcagcccgtgccagaacgggggcacctgcctgcagcacacccaggtgagctacgagtgtctgtgcaagcccgagttcacaggtctcacctgtgtcaagaagcgcgcgctgagcccccagcaggtcacccgtctgcccaacggctatgggctggcctaccgcctgacccctggggtgcacgagctgccggtgcagcagccggagcaccgcatcctgaaggtgtccatgaaagagctcaacaagaaaacccctctcctcaccgagggccaggccatctgcttcaccatcctgggcgtgctcaccagcctggtggtgctgggcactgtgggtatcgtcttcctcaacaagtgcgagacctgggtgtccaacctgcgctacaaccacatgctgcggaagaagaagaacctgctgcttcagtacaacagcggggaggacctggccgtcaacatcatcttccccgagaagatcgacatgaccaccttcagcaaggaggccggcgacgaggagatctaa
Sequence Length
1152
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,067 Da
NCBI Official Full Name
Homo sapiens delta-like 1 homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
delta like non-canonical Notch ligand 1
NCBI Official Symbol
DLK1
NCBI Official Synonym Symbols
DLK; FA1; ZOG; pG2; DLK-1; PREF1; Delta1; Pref-1
NCBI Protein Information
protein delta homolog 1
UniProt Protein Name
Protein delta homolog 1
Protein Family
UniProt Gene Name
DLK1
UniProt Synonym Gene Names
DLK; DLK-1; FA1
UniProt Entry Name
DLK1_HUMAN

NCBI Description

This gene encodes a transmembrane protein that contains multiple epidermal growth factor repeats that functions as a regulator of cell growth. The encoded protein is involved in the differentiation of several cell types including adipocytes. This gene is located in a region of chromosome 14 frequently showing unparental disomy, and is imprinted and expressed from the paternal allele. A single nucleotide variant in this gene is associated with child and adolescent obesity and shows polar overdominance, where heterozygotes carrying an active paternal allele express the phenotype, while mutant homozygotes are normal. [provided by RefSeq, Nov 2015]

Uniprot Description

DLK1: May have a role in neuroendocrine differentiation. Monomer. Found within the stromal cells in close contact to the vascular structure of placental villi, yolk sac, fetal liver, adrenal cortex and pancreas and in the beta cells of the islets of Langerhans in the adult pancreas. Found also in some forms of neuroendocrine lung tumor tissue. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 14q32

Cellular Component: extracellular space

Biological Process: negative regulation of Notch signaling pathway

Research Articles on DLK1

Similar Products

Product Notes

The DLK1 dlk1 (Catalog #AAA1268780) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccgcga ccgaagccct cctgcgcgtc ctcttgctcc tgctggcttt cggccacagc acctatgggg ctgaatgctt cccggcctgc aacccccaaa atggattctg cgaggatgac aatgtttgca ggtgccagcc tggctggcag ggtccccttt gtgaccagtg cgtgacctct cccggctgcc ttcacggact ctgtggagaa cccgggcagt gcatttgcac cgacggctgg gacggggagc tctgtgatag agatgttcgg gcctgctcct cggccccctg tgccaacaac gggacctgcg tgagcctgga cgatggcctc tatgaatgct cctgtgcccc cgggtactcg ggaaaggact gccagaaaaa ggacgggccc tgtgtgatca acggctcccc ctgccagcac ggaggcacct gcgtggatga tgagggccgg gcctcccatg cctcctgcct gtgcccccct ggcttctcag gcaatttctg cgagatcgtg gccaacagct gcacccccaa cccatgcgag aacgacggcg tctgcactga catcgggggc gacttccgct gccggtgccc agccggcttc atcgacaaga cctgcagccg cccggtgacc aactgcgcca gcagcccgtg ccagaacggg ggcacctgcc tgcagcacac ccaggtgagc tacgagtgtc tgtgcaagcc cgagttcaca ggtctcacct gtgtcaagaa gcgcgcgctg agcccccagc aggtcacccg tctgcccaac ggctatgggc tggcctaccg cctgacccct ggggtgcacg agctgccggt gcagcagccg gagcaccgca tcctgaaggt gtccatgaaa gagctcaaca agaaaacccc tctcctcacc gagggccagg ccatctgctt caccatcctg ggcgtgctca ccagcctggt ggtgctgggc actgtgggta tcgtcttcct caacaagtgc gagacctggg tgtccaacct gcgctacaac cacatgctgc ggaagaagaa gaacctgctg cttcagtaca acagcgggga ggacctggcc gtcaacatca tcttccccga gaagatcgac atgaccacct tcagcaagga ggccggcgac gaggagatct aa. It is sometimes possible for the material contained within the vial of "DLK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.