Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DLC1 cdna clone

DLC1 cDNA Clone

Gene Names
DLC1; HP; ARHGAP7; STARD12; p122-RhoGAP
Synonyms
DLC1; DLC1 cDNA Clone; DLC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgtagctatcagaaagagaagctgggaagaacatgtgacccactggatgggacagccttttaattctgatgatcgtaacacagcatgtcatcatggactagtagctgacagcttgcaggcaagtatggaaaaagatgcaactctaaatgtggaccgcaaagagaagtgtgtttcactacctgactgctgtcatggatcagagctgagagattttcctgggaggccaatgggtcatctttcaaaggatgtggacgaaaatgacagccatgaaggtgaagatcagtttctttctctggaagccagcacagaaacactagtgcatgtttctgatgaggataacaatgctgatttatgccttacagatgataaacaggttttaaatacccaagggcagaaaacatcaggccaacatatgatccaaggagcaggctccttagaaaaggcactgcccatcatacaaagtaaccaagtttcttctaactcctggggaatagctggtgaaactgaattagcactggtaaaagaaagtggggagagaaaagttactgactctataagtaaaagcctggagctttgcaatgaaataagcttaagtgaaataaaagatgcacccaaagtaaatgcagtggatactttgaacgtgaaagatattgcacctgagaaacaattgcttaactctgctgtaattgctcagcaacgaaggaaacctgacccccctaaagatgaaaatgaaagaagcacctgcaatgtagtacaagatgagttcttggatactccttgcacaaacagaggactgccattattaaaaacagattttggaagctgccttctgcagcctccttcctgccccaatggaatgtcagctgaaaatggcctggagaagagtggtttttcacaacatcaaaacaaaagtccaccaaaggtcaaggcagaagatggcatgcagtgtttacaattaaaggagaccctggccacccaggaacccacagataaccaagtcagacttcgtaagagaaaggaaataagagaagatcgagatagggcgcggctggactccatggtgctgctgattatgaaactggaccagcttgatcaggacatagaaaatgccctcagcaccagctcctctccatcaggcacaccaacaaacctgcggcggcacgttcctgatctggaatcaggatctgaaagtggagcagataccatttcagtaaatcagacacgagtaaatttgtcttctgacactgagtccacggacctcccatcttccactccagtagccaattctggaaccaaacccaagactacggctattcaaggtatttcagagaaggaaaaggctggtaagttgacattttggttctgttttctcgccaatctattttag
Sequence Length
1392
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
126,746 Da
NCBI Official Full Name
Homo sapiens deleted in liver cancer 1, mRNA
NCBI Official Synonym Full Names
DLC1 Rho GTPase activating protein
NCBI Official Symbol
DLC1
NCBI Official Synonym Symbols
HP; ARHGAP7; STARD12; p122-RhoGAP
NCBI Protein Information
rho GTPase-activating protein 7
UniProt Protein Name
Rho GTPase-activating protein 7
Protein Family
UniProt Gene Name
DLC1
UniProt Synonym Gene Names
ARHGAP7; KIAA1723; STARD12; DLC-1; StARD12
UniProt Entry Name
RHG07_HUMAN

NCBI Description

This gene encodes a GTPase-activating protein (GAP) that is a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins. GAP family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. This gene functions as a tumor suppressor gene in a number of common cancers, including prostate, lung, colorectal, and breast cancers. Multiple transcript variants due to alternative promoters and alternative splicing have been found for this gene.[provided by RefSeq, Apr 2010]

Uniprot Description

DLC1: Functions as a GTPase-activating protein specific for Rho and an activator of PLCD1 in vivo and induces morphological changes and detachment through cytoskeletal reorganization. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: GAPs; GAPs, Rac/Rho; Tumor suppressor

Chromosomal Location of Human Ortholog: 8p22

Cellular Component: caveola; cortical actin cytoskeleton; cytoplasm; cytosol; focal adhesion; nucleus

Molecular Function: GTPase activator activity; protein binding; SH2 domain binding

Biological Process: actin cytoskeleton organization and biogenesis; apoptosis; caspase activation; focal adhesion formation; forebrain development; heart morphogenesis; hindbrain morphogenesis; negative regulation of cell migration; negative regulation of cell proliferation; negative regulation of focal adhesion formation; negative regulation of Rho protein signal transduction; negative regulation of stress fiber formation; neural tube closure; positive regulation of protein amino acid dephosphorylation; regulation of actin cytoskeleton organization and biogenesis; regulation of cell shape; regulation of small GTPase mediated signal transduction

Disease: Colorectal Cancer

Research Articles on DLC1

Similar Products

Product Notes

The DLC1 dlc1 (Catalog #AAA1269829) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgtag ctatcagaaa gagaagctgg gaagaacatg tgacccactg gatgggacag ccttttaatt ctgatgatcg taacacagca tgtcatcatg gactagtagc tgacagcttg caggcaagta tggaaaaaga tgcaactcta aatgtggacc gcaaagagaa gtgtgtttca ctacctgact gctgtcatgg atcagagctg agagattttc ctgggaggcc aatgggtcat ctttcaaagg atgtggacga aaatgacagc catgaaggtg aagatcagtt tctttctctg gaagccagca cagaaacact agtgcatgtt tctgatgagg ataacaatgc tgatttatgc cttacagatg ataaacaggt tttaaatacc caagggcaga aaacatcagg ccaacatatg atccaaggag caggctcctt agaaaaggca ctgcccatca tacaaagtaa ccaagtttct tctaactcct ggggaatagc tggtgaaact gaattagcac tggtaaaaga aagtggggag agaaaagtta ctgactctat aagtaaaagc ctggagcttt gcaatgaaat aagcttaagt gaaataaaag atgcacccaa agtaaatgca gtggatactt tgaacgtgaa agatattgca cctgagaaac aattgcttaa ctctgctgta attgctcagc aacgaaggaa acctgacccc cctaaagatg aaaatgaaag aagcacctgc aatgtagtac aagatgagtt cttggatact ccttgcacaa acagaggact gccattatta aaaacagatt ttggaagctg ccttctgcag cctccttcct gccccaatgg aatgtcagct gaaaatggcc tggagaagag tggtttttca caacatcaaa acaaaagtcc accaaaggtc aaggcagaag atggcatgca gtgtttacaa ttaaaggaga ccctggccac ccaggaaccc acagataacc aagtcagact tcgtaagaga aaggaaataa gagaagatcg agatagggcg cggctggact ccatggtgct gctgattatg aaactggacc agcttgatca ggacatagaa aatgccctca gcaccagctc ctctccatca ggcacaccaa caaacctgcg gcggcacgtt cctgatctgg aatcaggatc tgaaagtgga gcagatacca tttcagtaaa tcagacacga gtaaatttgt cttctgacac tgagtccacg gacctcccat cttccactcc agtagccaat tctggaacca aacccaagac tacggctatt caaggtattt cagagaagga aaaggctggt aagttgacat tttggttctg ttttctcgcc aatctatttt ag. It is sometimes possible for the material contained within the vial of "DLC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.