Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DKK2 cdna clone

DKK2 cDNA Clone

Gene Names
DKK2; DKK-2
Synonyms
DKK2; DKK2 cDNA Clone; DKK2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgcgttgatgcggagcaaggattcgtcctgctgcctgctcctactggccgcggtgctgatggtggagagctcacagatcggcagttcgcgggccaaactcaactccatcaagtcctctctgggcggggagacgcctggtcaggccgccaatcgatctgcgggcatgtaccaaggactggcattcggcggcagtaagaagggcaaaaacctggggcaggcctacccttgtagcagtgataaggagtgtgaagttgggaggtattgccacagtccccaccaaggatcatcggcctgcatggtgtgtcggagaaaaaagaagcgctgccaccgagatggcatgtgctgccccagtacccgctgcaataatggcatctgtatcccagttactgaaagcatcttaacccctcacatcccggctctggatggtactcagcacagagatcgaaaccacggtcattactcaaaccatgacttgggatggcagaatctaggaagaccacacactaagatgtcacatataaaagggcatgaaggagacccctgcctacgatcatcagactgcattgaagggttttgctgtgctcgtcatttctggaccaaaatctgcaaaccagtgctccatcagggggaagtctgtaccaaacaacgcaagaagggttctcatgggctggaaattttccagcgttgcgactgtgcgaagggcctgtcttgcaaagtatggaaagatgccacctactcctccaaagccagactccatgtgtgtcagaaaatttga
Sequence Length
780
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,447 Da
NCBI Official Full Name
Homo sapiens dickkopf homolog 2 (Xenopus laevis), mRNA
NCBI Official Synonym Full Names
dickkopf WNT signaling pathway inhibitor 2
NCBI Official Symbol
DKK2
NCBI Official Synonym Symbols
DKK-2
NCBI Protein Information
dickkopf-related protein 2
UniProt Protein Name
Dickkopf-related protein 2
Protein Family
UniProt Gene Name
DKK2
UniProt Synonym Gene Names
Dickkopf-2; Dkk-2; hDkk-2
UniProt Entry Name
DKK2_HUMAN

NCBI Description

This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. It can act as either an agonist or antagonist of Wnt/beta-catenin signaling, depending on the cellular context and the presence of the co-factor kremen 2. Activity of this protein is also modulated by binding to the Wnt co-receptor LDL-receptor related protein 6 (LRP6). [provided by RefSeq, Jul 2008]

Uniprot Description

DKK2: Antagonizes canonical Wnt signaling by inhibiting LRP5/6 interaction with Wnt and by forming a ternary complex with the transmembrane protein KREMEN that promotes internalization of LRP5/6. DKKs play an important role in vertebrate development, where they locally inhibit Wnt regulated processes such as antero- posterior axial patterning, limb development, somitogenesis and eye formation. In the adult, Dkks are implicated in bone formation and bone disease, cancer and Alzheimer disease. Interacts with LRP5 and LRP6. Expressed in heart, brain, skeletal muscle and lung. Belongs to the dickkopf family.

Protein type: Secreted; Secreted, signal peptide; Inhibitor

Chromosomal Location of Human Ortholog: 4q25

Cellular Component: extracellular space

Research Articles on DKK2

Similar Products

Product Notes

The DKK2 dkk2 (Catalog #AAA1278812) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcgt tgatgcggag caaggattcg tcctgctgcc tgctcctact ggccgcggtg ctgatggtgg agagctcaca gatcggcagt tcgcgggcca aactcaactc catcaagtcc tctctgggcg gggagacgcc tggtcaggcc gccaatcgat ctgcgggcat gtaccaagga ctggcattcg gcggcagtaa gaagggcaaa aacctggggc aggcctaccc ttgtagcagt gataaggagt gtgaagttgg gaggtattgc cacagtcccc accaaggatc atcggcctgc atggtgtgtc ggagaaaaaa gaagcgctgc caccgagatg gcatgtgctg ccccagtacc cgctgcaata atggcatctg tatcccagtt actgaaagca tcttaacccc tcacatcccg gctctggatg gtactcagca cagagatcga aaccacggtc attactcaaa ccatgacttg ggatggcaga atctaggaag accacacact aagatgtcac atataaaagg gcatgaagga gacccctgcc tacgatcatc agactgcatt gaagggtttt gctgtgctcg tcatttctgg accaaaatct gcaaaccagt gctccatcag ggggaagtct gtaccaaaca acgcaagaag ggttctcatg ggctggaaat tttccagcgt tgcgactgtg cgaagggcct gtcttgcaaa gtatggaaag atgccaccta ctcctccaaa gccagactcc atgtgtgtca gaaaatttga. It is sometimes possible for the material contained within the vial of "DKK2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.