Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DKC1 cdna clone

DKC1 cDNA Clone

Gene Names
DKC1; DKC; CBF5; DKCX; NAP57; NOLA4; XAP101
Synonyms
DKC1; DKC1 cDNA Clone; DKC1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggatgcggaagtaattattttgccaaagaaacataagaagaaaaaggagcggaagtcattgccagaagaagatgtagccgaaatacaacacgctgaagaatttcttatcaaacctgaatccaaagttgctaagttggacacgtctcagtggccccttttgctaaagaattttgataagctgaatgtaaggacaacacactatacacctcttgcatgtggttcaaatcctctgaagagagagattggggactatatcaggacaggtttcattaatcttgacaagccctctaacccctcttcccatgaggtggtagcctggattcgacggatacttcgggtggagaagacagggcacagtggtactctggatcccaaggtgactggttgtttaatcgtgtgcatagaacgagccactcgcttggtgaagtcacaacagagtgcaggcaaagagtatgtggggattgtccggctgcacaatgctattgaaggggggacccagctttctagggccctagaaactctgacaggtgccttattccagcgacccccacttattgctgcagtaaagaggcagctccgagtgaggaccatctacgagagcaaaatgattgaatacgatcctgaaagaagattaggaatcttttgggtgagttgtgaggctggcacctacattcggacattatgtgtgcaccttggtttgttattgggagttggtggtcagatgcaggagcttcggagggttcgttctggagtcatgagtgaaaaggaccacatggtgacaatgcatgatgtgcttgatgctcagtggctgtatgataaccacaaggatgagagttacctgcggcgagttgtttaccctttggaaaagctgttgacatctcataaacggctggttatgaaagacagtgcagtaaatgccatctgctatggggccaagattatgcttccaggtgttcttcgatatgaggacggcattgaggtcaatcaggagattgtggttatcaccaccaaaggagaagcaatctgcatggctattgcattaatgaccacagcggtcatctctacctgcgaccatggtatagtagccaagatcaagagagtgatcatggagagagacacttaccctcggaagtggggtttaggtccaaaggcaagtcagaagaagctgatgatcaagcagggccttctggacaagcatgggaagcccacagacagcacacctgccacctggaagcaggagtatgttgactacagtgagtctgccaaaaaagaggtggttgctgaagtggtaaaagccccgcaggtagttgccgaagcagcaaaaactgcgaagcggaagcgagagagtgagagtgaaagtgacgagactcctccagcagctcctcagttgatcaagaaggaaaagaagaagagtaagaaggacaagaaggccaaagctggtctggagagcggggccgagcctggagatggggacagtgataccaccaagaagaagaagaagaagaagaaagcaaaagaggtagaattggtttctgagtag
Sequence Length
1545
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,603 Da
NCBI Official Full Name
Homo sapiens dyskeratosis congenita 1, dyskerin, mRNA
NCBI Official Synonym Full Names
dyskerin pseudouridine synthase 1
NCBI Official Symbol
DKC1
NCBI Official Synonym Symbols
DKC; CBF5; DKCX; NAP57; NOLA4; XAP101
NCBI Protein Information
H/ACA ribonucleoprotein complex subunit 4
UniProt Protein Name
H/ACA ribonucleoprotein complex subunit 4
UniProt Gene Name
DKC1
UniProt Synonym Gene Names
NOLA4
UniProt Entry Name
DKC1_HUMAN

NCBI Description

This gene functions in two distinct complexes. It plays an active role in telomerase stabilization and maintenance, as well as recognition of snoRNAs containing H/ACA sequences which provides stability during biogenesis and assembly into H/ACA small nucleolar RNA ribonucleoproteins (snoRNPs). This gene is highly conserved and widely expressed, and may play additional roles in nucleo-cytoplasmic shuttling, DNA damage response, and cell adhesion. Mutations have been associated with X-linked dyskeratosis congenita. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Uniprot Description

dyskerin: Isoform 1: Required for ribosome biogenesis and telomere maintenance. Probable catalytic subunit of H/ACA small nucleolar ribonucleoprotein (H/ACA snoRNP) complex, which catalyzes pseudouridylation of rRNA. This involves the isomerization of uridine such that the ribose is subsequently attached to C5, instead of the normal N1. Each rRNA can contain up to 100 pseudouridine ('psi') residues, which may serve to stabilize the conformation of rRNAs. Also required for correct processing or intranuclear trafficking of TERC, the RNA component of the telomerase reverse transcriptase (TERT) holoenzyme. Defects in DKC1 are a cause of dyskeratosis congenita X- linked recessive (XDKC). XDKC is a rare, progressive bone marrow failure syndrome characterized by the triad of reticulated skin hyperpigmentation, nail dystrophy, and mucosal leukoplakia. Early mortality is often associated with bone marrow failure, infections, fatal pulmonary complications, or malignancy. Defects in DKC1 are the cause of Hoyeraal-Hreidarsson syndrome (HHS). HHS is a multisystem disorder affecting males and is characterized by aplastic anemia, immunodeficiency, microcephaly, cerebellar hypoplasia, and growth retardation. Belongs to the pseudouridine synthase TruB family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleolus; Isomerase; RNA-binding; RNA processing; EC 5.4.99.-; Lyase

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: nucleolus; nucleoplasm; nucleus; telomerase holoenzyme complex

Molecular Function: protein binding; pseudouridine synthase activity; RNA binding; telomerase activity

Biological Process: box H/ACA snoRNA 3'-end processing; cell proliferation; positive regulation of telomerase activity; RNA processing; rRNA processing; rRNA pseudouridine synthesis; snRNA pseudouridine synthesis; telomere maintenance via telomerase

Disease: Dyskeratosis Congenita, X-linked

Research Articles on DKC1

Similar Products

Product Notes

The DKC1 dkc1 (Catalog #AAA1274817) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggatg cggaagtaat tattttgcca aagaaacata agaagaaaaa ggagcggaag tcattgccag aagaagatgt agccgaaata caacacgctg aagaatttct tatcaaacct gaatccaaag ttgctaagtt ggacacgtct cagtggcccc ttttgctaaa gaattttgat aagctgaatg taaggacaac acactataca cctcttgcat gtggttcaaa tcctctgaag agagagattg gggactatat caggacaggt ttcattaatc ttgacaagcc ctctaacccc tcttcccatg aggtggtagc ctggattcga cggatacttc gggtggagaa gacagggcac agtggtactc tggatcccaa ggtgactggt tgtttaatcg tgtgcataga acgagccact cgcttggtga agtcacaaca gagtgcaggc aaagagtatg tggggattgt ccggctgcac aatgctattg aaggggggac ccagctttct agggccctag aaactctgac aggtgcctta ttccagcgac ccccacttat tgctgcagta aagaggcagc tccgagtgag gaccatctac gagagcaaaa tgattgaata cgatcctgaa agaagattag gaatcttttg ggtgagttgt gaggctggca cctacattcg gacattatgt gtgcaccttg gtttgttatt gggagttggt ggtcagatgc aggagcttcg gagggttcgt tctggagtca tgagtgaaaa ggaccacatg gtgacaatgc atgatgtgct tgatgctcag tggctgtatg ataaccacaa ggatgagagt tacctgcggc gagttgttta ccctttggaa aagctgttga catctcataa acggctggtt atgaaagaca gtgcagtaaa tgccatctgc tatggggcca agattatgct tccaggtgtt cttcgatatg aggacggcat tgaggtcaat caggagattg tggttatcac caccaaagga gaagcaatct gcatggctat tgcattaatg accacagcgg tcatctctac ctgcgaccat ggtatagtag ccaagatcaa gagagtgatc atggagagag acacttaccc tcggaagtgg ggtttaggtc caaaggcaag tcagaagaag ctgatgatca agcagggcct tctggacaag catgggaagc ccacagacag cacacctgcc acctggaagc aggagtatgt tgactacagt gagtctgcca aaaaagaggt ggttgctgaa gtggtaaaag ccccgcaggt agttgccgaa gcagcaaaaa ctgcgaagcg gaagcgagag agtgagagtg aaagtgacga gactcctcca gcagctcctc agttgatcaa gaaggaaaag aagaagagta agaaggacaa gaaggccaaa gctggtctgg agagcggggc cgagcctgga gatggggaca gtgataccac caagaagaag aagaagaaga agaaagcaaa agaggtagaa ttggtttctg agtag. It is sometimes possible for the material contained within the vial of "DKC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.