Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DISP1 cdna clone

DISP1 cDNA Clone

Gene Names
DISP1; DISPA
Synonyms
DISP1; DISP1 cDNA Clone; DISP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctatgagcaatggaaacaatgattttgtggttctgagcaacagcagcatcgcaaccagtgctgctaacccgagtcccctcaccccctgtgatggagaccatgcagcccagcagctcacacccaaagaagcaacaagaacaaaagtgagtccaaatggatgcctgcaacttaatggcacggtcaaatcatcctttctgcctttagacaaccaaagaatgcctcagatgttaccccaatgctgccatccttgcccataccatcaccctttgactagccatagcagtcaccaagagtgccatcccgaggctggccctgcagcaccctctgctttggcctcgtgttgcatgcagccacactccgagtattctgcatctctttgtccaaatcattcacctgtgtatcagactacgtgctgtcttcagccctctccatccttctgcctgcatcatccgtggcctgaccattttcagcatcagcctgtgcaacagcacatagccaacataagaccatccagacctttcaagttgccaaaaagttatgcagccctgatagccgactggccggtggtggtcttgggcatgtgcaccatgttcatcgtagtctgtgccttggttggagtattagtgccagagctccctgacttctctgatccattgctgggttttgaaccaagaggaacagcaataggccagagattggtcacatggaataatatggtgaaaaatacaggatacaaagcaacattagcaaattatccctttaaatatgcagatgaacaagccaaaagccatcgggatgatagatggtcagatgatcattatgaaagagagaaaagagaagttgactggaacttccacaaggacagctttttctgcgacgttccaagtgaccgatattccagagtggtatttacttcatctggaggggagacattatggaatttacctgcaattaaatcaatgtgcaatgtagataattccaggatcagatctcatccccagtttggtgatctctgccagaggaccactgctgcctcctgctgccccagctggacactgggaaactacatcgccattctgaacaatagatcgtcctgtcagaaaatagttgagcgagacgtttctcataccttgaagctgcttcggacttgtgccaaacactaccaaaatggcactctggggccagactgctgggacatggcagccagaagaaaggaccagctcaagtgcaccaatgtgccacgcaaatgtaccaagtacaatgctgtgtaccagatcctccattacttggtggacaaagactttatgaccccaaagacggctgactatgccacgccagctttaaaatacagcatgctcttctctcccacagagaaaggggagagcatgatgaacatttacttggacaactttgaaaactggaactcttctgacggcgtgactaccatcaccgggattgagtttggtatcaaacacagtttgtttcaggattatcttctaatggatactgtgtatcctgccatagccattgtgattgtccttttagttatgtgtgtctacaccaagtccatgtttatcactctgatgacaatgtttgcaataatcagttctttgattgtttcctaa
Sequence Length
1629
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
170,934 Da
NCBI Official Full Name
Homo sapiens dispatched homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
dispatched RND transporter family member 1
NCBI Official Symbol
DISP1
NCBI Official Synonym Symbols
DISPA
NCBI Protein Information
protein dispatched homolog 1
UniProt Protein Name
Protein dispatched homolog 1
Protein Family
UniProt Gene Name
DISP1
UniProt Synonym Gene Names
DISPA
UniProt Entry Name
DISP1_HUMAN

NCBI Description

The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]

Uniprot Description

DISP1: Functions in hedgehog (Hh) signaling. Regulates the release and extracellular accumulation of cholesterol-modified hedgehog proteins and is hence required for effective production of the Hh signal. Belongs to the dispatched family.

Protein type: Transporter; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q41

Molecular Function: peptide transporter activity; protein binding

Biological Process: peptide transport; smoothened signaling pathway

Research Articles on DISP1

Similar Products

Product Notes

The DISP1 disp1 (Catalog #AAA1267379) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctatga gcaatggaaa caatgatttt gtggttctga gcaacagcag catcgcaacc agtgctgcta acccgagtcc cctcaccccc tgtgatggag accatgcagc ccagcagctc acacccaaag aagcaacaag aacaaaagtg agtccaaatg gatgcctgca acttaatggc acggtcaaat catcctttct gcctttagac aaccaaagaa tgcctcagat gttaccccaa tgctgccatc cttgcccata ccatcaccct ttgactagcc atagcagtca ccaagagtgc catcccgagg ctggccctgc agcaccctct gctttggcct cgtgttgcat gcagccacac tccgagtatt ctgcatctct ttgtccaaat cattcacctg tgtatcagac tacgtgctgt cttcagccct ctccatcctt ctgcctgcat catccgtggc ctgaccattt tcagcatcag cctgtgcaac agcacatagc caacataaga ccatccagac ctttcaagtt gccaaaaagt tatgcagccc tgatagccga ctggccggtg gtggtcttgg gcatgtgcac catgttcatc gtagtctgtg ccttggttgg agtattagtg ccagagctcc ctgacttctc tgatccattg ctgggttttg aaccaagagg aacagcaata ggccagagat tggtcacatg gaataatatg gtgaaaaata caggatacaa agcaacatta gcaaattatc cctttaaata tgcagatgaa caagccaaaa gccatcggga tgatagatgg tcagatgatc attatgaaag agagaaaaga gaagttgact ggaacttcca caaggacagc tttttctgcg acgttccaag tgaccgatat tccagagtgg tatttacttc atctggaggg gagacattat ggaatttacc tgcaattaaa tcaatgtgca atgtagataa ttccaggatc agatctcatc cccagtttgg tgatctctgc cagaggacca ctgctgcctc ctgctgcccc agctggacac tgggaaacta catcgccatt ctgaacaata gatcgtcctg tcagaaaata gttgagcgag acgtttctca taccttgaag ctgcttcgga cttgtgccaa acactaccaa aatggcactc tggggccaga ctgctgggac atggcagcca gaagaaagga ccagctcaag tgcaccaatg tgccacgcaa atgtaccaag tacaatgctg tgtaccagat cctccattac ttggtggaca aagactttat gaccccaaag acggctgact atgccacgcc agctttaaaa tacagcatgc tcttctctcc cacagagaaa ggggagagca tgatgaacat ttacttggac aactttgaaa actggaactc ttctgacggc gtgactacca tcaccgggat tgagtttggt atcaaacaca gtttgtttca ggattatctt ctaatggata ctgtgtatcc tgccatagcc attgtgattg tccttttagt tatgtgtgtc tacaccaagt ccatgtttat cactctgatg acaatgtttg caataatcag ttctttgatt gtttcctaa. It is sometimes possible for the material contained within the vial of "DISP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.