DIRAS2 cdna clone
DIRAS2 cDNA Clone
Gene Names
DIRAS2; Di-Ras2
Synonyms
DIRAS2; DIRAS2 cDNA Clone; DIRAS2 cdna clone
Sequence
atgcctgagcagagtaacgattaccgggtggccgtgtttggggctggcggtgttggcaagagctccctggtgttgaggtttgtgaaaggcacattccgggagagctacatcccgacggtggaagacacctaccggcaagtgatcagctgtgacaagagcatatgcacattgcagatcaccgacacgacggggagccaccagttcccggccatgcagcggctgtccatctccaaagggcacgccttcatcctggtgtactccattaccagccgacagtccttggaggagctcaagcccatctacgaacaaatctgcgagatcaaaggggacgtggagagcatccccatcatgctggtggggaacaagtgtgatgagagccccagccgcgaggtgcagagcagcgaggcggaggccttggcccgcacatggaagtgtgccttcatggagacctcagccaagctcaaccataacgtgaaggagcttttccaggagctgctcaacctggagaagcgcaggaccgtgagtctccagatcgacgggaaaaagagcaagcagcagaaaaggaaagagaagctcaaaggcaagtgcgtgatcatgtga
Sequence Length
600
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
22,485 Da
NCBI Official Full Name
Homo sapiens DIRAS family, GTP-binding RAS-like 2, mRNA
NCBI Official Synonym Full Names
DIRAS family GTPase 2
NCBI Official Symbol
DIRAS2
NCBI Official Synonym Symbols
Di-Ras2
NCBI Protein Information
GTP-binding protein Di-Ras2
UniProt Protein Name
GTP-binding protein Di-Ras2
Protein Family
UniProt Gene Name
DIRAS2
UniProt Entry Name
DIRA2_HUMAN
NCBI Description
DIRAS2 belongs to a distinct branch of the functionally diverse Ras (see HRAS; MIM 190020) superfamily of monomeric GTPases.[supplied by OMIM, Apr 2004]
Uniprot Description
DIRAS2: a G protein of the small GTPase superfamily and the Di-Ras family. Displays low GTPase activity and exist predominantly in the GTP-bound form. Associated with the cytoplasmic face of the plasma membrane.
Protein type: G protein, monomeric; G protein, monomeric, di-Ras; G protein
Chromosomal Location of Human Ortholog: 9q22.2
Cellular Component: plasma membrane
Molecular Function: GTP binding
Biological Process: positive regulation of MAP kinase activity
Research Articles on DIRAS2
Similar Products
Product Notes
The DIRAS2 diras2 (Catalog #AAA1278496) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgagc agagtaacga ttaccgggtg gccgtgtttg gggctggcgg tgttggcaag agctccctgg tgttgaggtt tgtgaaaggc acattccggg agagctacat cccgacggtg gaagacacct accggcaagt gatcagctgt gacaagagca tatgcacatt gcagatcacc gacacgacgg ggagccacca gttcccggcc atgcagcggc tgtccatctc caaagggcac gccttcatcc tggtgtactc cattaccagc cgacagtcct tggaggagct caagcccatc tacgaacaaa tctgcgagat caaaggggac gtggagagca tccccatcat gctggtgggg aacaagtgtg atgagagccc cagccgcgag gtgcagagca gcgaggcgga ggccttggcc cgcacatgga agtgtgcctt catggagacc tcagccaagc tcaaccataa cgtgaaggag cttttccagg agctgctcaa cctggagaag cgcaggaccg tgagtctcca gatcgacggg aaaaagagca agcagcagaa aaggaaagag aagctcaaag gcaagtgcgt gatcatgtga. It is sometimes possible for the material contained within the vial of "DIRAS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
