Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DIAPH1 cdna clone

DIAPH1 cDNA Clone

Gene Names
DIAPH1; DIA1; DRF1; DFNA1; LFHL1; SCBMS; hDIA1
Synonyms
DIAPH1; DIAPH1 cDNA Clone; DIAPH1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagccgcccggcgggagcctggggcccggccgcgggacccgggacaagaagaagggccggagcccagatgagctgccctcggcgggcggcgacggcggcaaatctaagaaatttctggagagatttaccagcatgagaattaagaaggagaaggaaaagcccaattctgctcatagaaattcttctgcatcatatggggatgatcccacagcacagtcattgcaagatgtttcagatgaacaagtgctggttctctttgaacagatgctgctggatatgaacctgaatgaggagaaacagcaacctttgagggagaaggacatcatcatcaagagggagatggtgtcccaatacttgtacacctccaaggctggcatgagccagaaggagagctctaagtctgccatgatgtatattcaggagttgaggtcaggcttgcgggatatgcctctgctcagctgcctggagtcccttcgtgtgtctctcaacaacaaccctgtcagttgggtgcaaacatttggtgctgaaggcttggcctccttattggacattcttaaacgacttcatgatgagaaagaagagactgctgggagttacgatagccggaacaagcatgagatcattcgctgcttgaaagcttttatgaacaacaagtttggaatcaagaccatgttggagacagaagaaggaatcctactgctggtcagagccatggatcctgctgttcccaacatgatgattgatgcagctaagctgctttctgctctttgtattctaccgcagccagaggacatgaatgaaagggttttggaggcaatgacagaaagagctgagatggatgaagtggaacgtttccagccgctgctggatggattaaaaagtggaaccactattgcactgaaggttggatgcctacagctgatcaatgctctcatcacaccagcggaggaacttgacttccgagttcacatcagaagtgaactgatgcgtttggggctacatcaggtgttgcaggaccttcgagagattgaaaatgaagatatgagagtgcaactaaatgtgtttgatgaacaaggggaagaggattcctatgacctgaagggacggctggatgacattcgcatggagatggatgactttaatgaagtctttcagattctcttaaacacagtgaaggattcaaaggcagagccacacttcctttccatcctgcagcacttactcttggtccgaaatgactatgaggccagacctcagtactataagttgattgaagaatgtatttcccagatagttctgcacaagaacggggctgatcctgacttcaagtgccggcacctccagattgagattgagggattaattgatcaaatgattgataagacaaaggtggagaaatctgaagccaaagctgcagagctggaaaagaagttggactcagagttaacagcccgacatgagctacaggtggaaatgaaaaagatggaaagtgactttgagcagaagcttcaagatcttcagggagaaaaagatgcactgcattctgaaaagcagcaaattgccacagagaaacaggacctggaagcagaggtgtcccagctcacaggagaggttgccaagctgacaaaggaactggaagatgccaagaaagaaatggcttccctctctgcggcagctattactgtacctccttctgttcctagtcgtgctcctgttccccctgcccctcctttacctggtgactctggcactattattccaccaccacctgctcctggggatagtaccactcctcctcctcctcctcctcctcctcctccacctcctttgcctgggggtgtttgcatctcctcacccccttctttacctggaggtactgctatctctccaccccctcctttgtctggggatgctaccatccctccaccccctcctttgcctgagggtgttggcatcccttcaccctcttctttgcctggaggtactgccatccccccacctcctcctttgcctgggagtgctagaatccccccaccaccacctcctttgcctgggagtgctggaattccccccccacctcctcccttgcctggagaagcaggaatgccacctcctcctccccctcttcctggtggtcctggaatccctccacctcctccatttcccggaggccctggcattcctccacctccacccggaatgggtatgcctccacctcccccatttggatttggagttcctgcagccccagttctgccatttggattaacccccaaaaagctttataagccagaggtgcagctccggaggccaaactggtccaagcttgtggctgaggacctctcccaggactgcttctggacaaaggtgaaggaggaccgctttgagaacaatgaacttttcgccaaacttacccttaccttctctgcccagaccaagacttccaaagccaagaaggatcaagaaggtggagaagaaaagaaatctgtgcaaaagaaaaaagtaaaagagttaaaggtgttggattcaaagacagcccagaatctctcaatctttttgggttccttccgcatgccctatcaagagattaagaatgtcatcctggaggtgaatgaggctgttctgactgagtctatgatccagaacctcattaagcaaatgccagagccagagcagttaaaaatgctttctgaactgaaggatgaatatgatgacctggctgagtcagagcagtttggcgtggtgatgggcactgtgccccgactgcggcctcgcctcaatgccattctcttcaagctacaattcagcgagcaagtggagaatatcaagccagagattgtgtctgtcactgctgcatgtgaggagttacgtaagagtgagagcttttccaatctcctagagattaccttgcttgttggaaattacatgaatgctggctccagaaatgctggtgcttttggcttcaatatcagcttcctctgtaagcttcgagacaccaagtccacagatcagaagatgacgttgttacacttcttggctgagttgtgtgagaatgactatcccgatgtcctcaagtttccagacgagcttgcccatgtggagaaagccagccgagtttctgctgaaaacttgcaaaagaacctagatcagatgaagaaacaaatttctgatgtggaacgtgatgttcagaatttcccagctgccacagatgaaaaagacaagtttgttgaaaaaatgaccagctttgtgaaggatgcacaggaacagtataacaagctgcggatgatgcattctaacatggagaccctctataaggagctgggcgagtacttcctctttgaccccaagaagttgtctgttgaagaatttttcatggatcttcacaattttcggaatatgtttttgcaagcagtcaaggagaaccagaagcggcgggagacagaagaaaagatgaggcgagcaaaactagccaaggagaaggcagagaaggagcggctagagaagcagcagaagagagagcaactcatagacatgaatgcagagggcgatgagacaggtgtgatggacagtcttctagaagccctgcagtcaggggcagcattccgacggaagagagggccccgtcaagccaacaggaaggccgggtgtgcagtcacatctctgctagcttcggagctgaccaaggatgatgccatggctgctgttcctgccaaggtgtccaagaacagtgagacattccccacaatccttgaggaagccaaggagttggttggccgtgcaagctaa
Sequence Length
3789
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
140,289 Da
NCBI Official Full Name
Homo sapiens diaphanous homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
diaphanous related formin 1
NCBI Official Symbol
DIAPH1
NCBI Official Synonym Symbols
DIA1; DRF1; DFNA1; LFHL1; SCBMS; hDIA1
NCBI Protein Information
protein diaphanous homolog 1
UniProt Protein Name
Protein diaphanous homolog 1
Protein Family
UniProt Gene Name
DIAPH1
UniProt Synonym Gene Names
DIAP1; DRF1
UniProt Entry Name
DIAP1_HUMAN

NCBI Description

This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

Diaphanous-1: Acts in a Rho-dependent manner to recruit PFY1 to the membrane. Required for the assembly of F-actin structures, such as actin cables and stress fibers. Nucleates actin filaments. Binds to the barbed end of the actin filament and slows down actin polymerization and depolymerization. Required for cytokinesis, and transcriptional activation of the serum response factor. DFR proteins couple Rho and Src tyrosine kinase during signaling and the regulation of actin dynamics. Functions as a scaffold protein for MAPRE1 and APC to stabilize microtubules and promote cell migration. Has neurite outgrowth promoting activity. In hear cells, it may play a role in the regulation of actin polymerization in hair cells. The MEMO1-RHOA- DIAPH1 signaling pathway plays an important role in ERBB2- dependent stabilization of microtubules at the cell cortex. It controls the localization of APC and CLASP2 to the cell membrane, via the regulation of GSK3B activity. In turn, membrane-bound APC allows the localization of the MACF1 to the cell membrane, which is required for microtubule capture and stabilization. Plays a role in the regulation of cell morphology and cytoskeletal organization. Required in the control of cell shape. Homodimer. Interacts with the GTP-bound form of RHOA. Interacts with RHOC, PFY1, MAPRE1, BAIAP2 and APC. Interacts with SCAI. Interacts with DCAF7, via FH2 domain. Interacts with NCDN. Expressed in brain, heart, placenta, lung, kidney, pancreas, liver, skeletal muscle and cochlea. Belongs to the formin homology family. Diaphanous subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Actin-binding; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 5q31

Cellular Component: cytosol

Molecular Function: protein binding

Biological Process: cytoskeleton organization and biogenesis; regulation of cell shape; regulation of microtubule-based process; regulation of release of sequestered calcium ion into cytosol

Disease: Deafness, Autosomal Dominant 1; Seizures, Cortical Blindness, And Microcephaly Syndrome

Research Articles on DIAPH1

Similar Products

Product Notes

The DIAPH1 diaph1 (Catalog #AAA1266895) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagccgc ccggcgggag cctggggccc ggccgcggga cccgggacaa gaagaagggc cggagcccag atgagctgcc ctcggcgggc ggcgacggcg gcaaatctaa gaaatttctg gagagattta ccagcatgag aattaagaag gagaaggaaa agcccaattc tgctcataga aattcttctg catcatatgg ggatgatccc acagcacagt cattgcaaga tgtttcagat gaacaagtgc tggttctctt tgaacagatg ctgctggata tgaacctgaa tgaggagaaa cagcaacctt tgagggagaa ggacatcatc atcaagaggg agatggtgtc ccaatacttg tacacctcca aggctggcat gagccagaag gagagctcta agtctgccat gatgtatatt caggagttga ggtcaggctt gcgggatatg cctctgctca gctgcctgga gtcccttcgt gtgtctctca acaacaaccc tgtcagttgg gtgcaaacat ttggtgctga aggcttggcc tccttattgg acattcttaa acgacttcat gatgagaaag aagagactgc tgggagttac gatagccgga acaagcatga gatcattcgc tgcttgaaag cttttatgaa caacaagttt ggaatcaaga ccatgttgga gacagaagaa ggaatcctac tgctggtcag agccatggat cctgctgttc ccaacatgat gattgatgca gctaagctgc tttctgctct ttgtattcta ccgcagccag aggacatgaa tgaaagggtt ttggaggcaa tgacagaaag agctgagatg gatgaagtgg aacgtttcca gccgctgctg gatggattaa aaagtggaac cactattgca ctgaaggttg gatgcctaca gctgatcaat gctctcatca caccagcgga ggaacttgac ttccgagttc acatcagaag tgaactgatg cgtttggggc tacatcaggt gttgcaggac cttcgagaga ttgaaaatga agatatgaga gtgcaactaa atgtgtttga tgaacaaggg gaagaggatt cctatgacct gaagggacgg ctggatgaca ttcgcatgga gatggatgac tttaatgaag tctttcagat tctcttaaac acagtgaagg attcaaaggc agagccacac ttcctttcca tcctgcagca cttactcttg gtccgaaatg actatgaggc cagacctcag tactataagt tgattgaaga atgtatttcc cagatagttc tgcacaagaa cggggctgat cctgacttca agtgccggca cctccagatt gagattgagg gattaattga tcaaatgatt gataagacaa aggtggagaa atctgaagcc aaagctgcag agctggaaaa gaagttggac tcagagttaa cagcccgaca tgagctacag gtggaaatga aaaagatgga aagtgacttt gagcagaagc ttcaagatct tcagggagaa aaagatgcac tgcattctga aaagcagcaa attgccacag agaaacagga cctggaagca gaggtgtccc agctcacagg agaggttgcc aagctgacaa aggaactgga agatgccaag aaagaaatgg cttccctctc tgcggcagct attactgtac ctccttctgt tcctagtcgt gctcctgttc cccctgcccc tcctttacct ggtgactctg gcactattat tccaccacca cctgctcctg gggatagtac cactcctcct cctcctcctc ctcctcctcc tccacctcct ttgcctgggg gtgtttgcat ctcctcaccc ccttctttac ctggaggtac tgctatctct ccaccccctc ctttgtctgg ggatgctacc atccctccac cccctccttt gcctgagggt gttggcatcc cttcaccctc ttctttgcct ggaggtactg ccatcccccc acctcctcct ttgcctggga gtgctagaat ccccccacca ccacctcctt tgcctgggag tgctggaatt ccccccccac ctcctccctt gcctggagaa gcaggaatgc cacctcctcc tccccctctt cctggtggtc ctggaatccc tccacctcct ccatttcccg gaggccctgg cattcctcca cctccacccg gaatgggtat gcctccacct cccccatttg gatttggagt tcctgcagcc ccagttctgc catttggatt aacccccaaa aagctttata agccagaggt gcagctccgg aggccaaact ggtccaagct tgtggctgag gacctctccc aggactgctt ctggacaaag gtgaaggagg accgctttga gaacaatgaa cttttcgcca aacttaccct taccttctct gcccagacca agacttccaa agccaagaag gatcaagaag gtggagaaga aaagaaatct gtgcaaaaga aaaaagtaaa agagttaaag gtgttggatt caaagacagc ccagaatctc tcaatctttt tgggttcctt ccgcatgccc tatcaagaga ttaagaatgt catcctggag gtgaatgagg ctgttctgac tgagtctatg atccagaacc tcattaagca aatgccagag ccagagcagt taaaaatgct ttctgaactg aaggatgaat atgatgacct ggctgagtca gagcagtttg gcgtggtgat gggcactgtg ccccgactgc ggcctcgcct caatgccatt ctcttcaagc tacaattcag cgagcaagtg gagaatatca agccagagat tgtgtctgtc actgctgcat gtgaggagtt acgtaagagt gagagctttt ccaatctcct agagattacc ttgcttgttg gaaattacat gaatgctggc tccagaaatg ctggtgcttt tggcttcaat atcagcttcc tctgtaagct tcgagacacc aagtccacag atcagaagat gacgttgtta cacttcttgg ctgagttgtg tgagaatgac tatcccgatg tcctcaagtt tccagacgag cttgcccatg tggagaaagc cagccgagtt tctgctgaaa acttgcaaaa gaacctagat cagatgaaga aacaaatttc tgatgtggaa cgtgatgttc agaatttccc agctgccaca gatgaaaaag acaagtttgt tgaaaaaatg accagctttg tgaaggatgc acaggaacag tataacaagc tgcggatgat gcattctaac atggagaccc tctataagga gctgggcgag tacttcctct ttgaccccaa gaagttgtct gttgaagaat ttttcatgga tcttcacaat tttcggaata tgtttttgca agcagtcaag gagaaccaga agcggcggga gacagaagaa aagatgaggc gagcaaaact agccaaggag aaggcagaga aggagcggct agagaagcag cagaagagag agcaactcat agacatgaat gcagagggcg atgagacagg tgtgatggac agtcttctag aagccctgca gtcaggggca gcattccgac ggaagagagg gccccgtcaa gccaacagga aggccgggtg tgcagtcaca tctctgctag cttcggagct gaccaaggat gatgccatgg ctgctgttcc tgccaaggtg tccaagaaca gtgagacatt ccccacaatc cttgaggaag ccaaggagtt ggttggccgt gcaagctaa. It is sometimes possible for the material contained within the vial of "DIAPH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.