Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DHX58 cdna clone

DHX58 cDNA Clone

Gene Names
DHX58; LGP2; RLR-3; D11LGP2; D11lgp2e
Synonyms
DHX58; DHX58 cDNA Clone; DHX58 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcttcggtcctaccaatgggaggtgatcatgcctgccctggagggcaagaatatcatcatctggctgcccacgggtgccgggaagacccgggcggctgcttatgtggccaagcggcacctagagactgtggatggagccaaggtggttgtattggtcaacagggtgcacctggtgacccagcatggtgaagagttcaggcgcatgctggatggacgctggaccgtgacaaccctgagtggggacatgggaccacgtgctggctttggccacctggcccggtgccatgacctgctcatctgcacagcagagcttctgcagatggcactgaccagccccgaggaggaggagcacgtggagctcactgtcttctccctgatcgtggtggatgagtgccaccacacgcacaaggacaccgtctacaacgtcatcatgagccagtacctagaacttaaactccagagggcacagccgctaccccaggtgctgggtctcacagcctccccaggcactggcggggcctccaaactcgatggggccatcaaccacgtcctgcagctctgtgccaacttggacacgtggtgcatcatgtcaccccagaactgctgcccccagctgcaggagcacagccaacagccttgcaaacagtacaacctctgccacaggcgcagccaggatccgtttggggacttgctgaagaagctcatggaccaaatccatgaccacctggagatgcctgagttgagccggaaatttgggacgcaaatgtatgagcagcaggtggtgaagctgagtgaggctgcggctttggctgggcttcaggagcaacgggtgtatgcgcttcacctgaggcgctacaatgacgcgctgctcatccatgacaccgtccgcgccgtggatgccttggctgcgctgcaggatttctatcacagggagcacgtcactaaaacccagatcctgtgtgccgagcgccggctgctggccctgttcgatgaccgcaagaatgagctggcccacttggcaactcatggcccagagaatccaaaactggagatgctggaaaagatcctgcaaaggcagttcagtagctctaacagccctcggggtatcatcttcacccgcacccgccaaagcgcacactccctcctgctctggctccagcagcagcagggcctgcagactgtggacatccgggcccagctactgattggggctgggaacagcagccagagcacccacatgacccagagggaccagcaagaagtgatccagaagttccaagatggaaccctgaaccttctggtggccacgagtgtggcggaggaggggctggacatcccacattgcaatgtggtggtgcgttatgggctcttgaccaatgaaatctccatggtccaggccaggggccgtgcccgggccgatcagagtgtatacgcgtttgtagcaactgaaggtagccgggagctgaagcgggagctgatcaacgaggcgctggagacgctgatggagcaggcagtggctgctgtgcagaaaatggaccaggccgagtaccaggccaagatccgggatctgcagcaggcagccttgaccaagcgggcggcccaggcagcccagcgggagaaccagcggcagcagttcccagtggagcacgtgcagctactctgcatcaactgcatggtggctgtgggccatggcagcgacctgcggaaggtggagggcacccaccatgtcaatgtgaaccccaacttctcgaactactataatgtctccagggatcctgtggtcatcaacaaagtcttcaaggactggaagcctgggggtgtcatcagctgcaggaactgtggggaggtctggggtctgcagatgatctacaagtcagtgaagctgccagtgctcaaagtccgcagcatgctgctggagacccctcaggggcggatccaggccaaaaagtggtcccgcgtgcccttctccgtgcctgactttgacttcctgcagcattgtgccgagaacttgtcggacctctccctggactga
Sequence Length
2037
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
76,613 Da
NCBI Official Full Name
Homo sapiens DEXH (Asp-Glu-X-His) box polypeptide 58, mRNA
NCBI Official Synonym Full Names
DEXH-box helicase 58
NCBI Official Symbol
DHX58
NCBI Official Synonym Symbols
LGP2; RLR-3; D11LGP2; D11lgp2e
NCBI Protein Information
probable ATP-dependent RNA helicase DHX58
UniProt Protein Name
Probable ATP-dependent RNA helicase DHX58
UniProt Gene Name
DHX58
UniProt Synonym Gene Names
D11LGP2E; LGP2; RLR-3; RLR
UniProt Entry Name
DHX58_HUMAN

Uniprot Description

DHX58: Acts as a regulator of DDX58/RIG-I and IFIH1/MDA5 mediated antiviral signaling. Cannot initiate antiviral signaling as it lacks the CARD domain required for activating MAVS/IPS1- dependent signaling events. Can have both negative and positive regulatory functions related to DDX58/RIG-I and IFIH1/MDA5 signaling and this role in regulating signaling may be complex and could probably depend on characteristics of the infecting virus or target cells, or both. Its inhibitory action on DDX58/RIG-I signaling may involve the following mechanisms: competition with DDX58/RIG-I for binding to the viral RNA, binding to DDX58/RIG-I and inhibiting its dimerization and interaction with MAVS/IPS1, competing with IKBKE in its binding to MAVS/IPS1 thereby inhibiting activation of interferon regulatory factor 3 (IRF3). Its positive regulatory role may involve unwinding or stripping nucleoproteins of viral RNA thereby facilitating their recognition by DDX58/RIG-I and IFIH1/MDA5. Involved in the innate immune response to various RNA viruses and some DNA viruses such as poxviruses, and also to the bacterial pathogen Listeria monocytogenes. Can bind both ssRNA and dsRNA, with a higher affinity for dsRNA. Shows a preference to 5'-triphosphorylated RNA, although it can recognize RNA lacking a 5'-triphosphate. Belongs to the helicase family. RLR subfamily.

Protein type: Helicase; EC 3.6.4.13; Inhibitor

Chromosomal Location of Human Ortholog: 17q21.2

Molecular Function: double-stranded RNA binding; protein binding; single-stranded RNA binding; zinc ion binding

Biological Process: negative regulation of innate immune response; negative regulation of interferon type I production; positive regulation of interferon type I production; regulation of innate immune response; response to virus

Research Articles on DHX58

Similar Products

Product Notes

The DHX58 dhx58 (Catalog #AAA1272633) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcttc ggtcctacca atgggaggtg atcatgcctg ccctggaggg caagaatatc atcatctggc tgcccacggg tgccgggaag acccgggcgg ctgcttatgt ggccaagcgg cacctagaga ctgtggatgg agccaaggtg gttgtattgg tcaacagggt gcacctggtg acccagcatg gtgaagagtt caggcgcatg ctggatggac gctggaccgt gacaaccctg agtggggaca tgggaccacg tgctggcttt ggccacctgg cccggtgcca tgacctgctc atctgcacag cagagcttct gcagatggca ctgaccagcc ccgaggagga ggagcacgtg gagctcactg tcttctccct gatcgtggtg gatgagtgcc accacacgca caaggacacc gtctacaacg tcatcatgag ccagtaccta gaacttaaac tccagagggc acagccgcta ccccaggtgc tgggtctcac agcctcccca ggcactggcg gggcctccaa actcgatggg gccatcaacc acgtcctgca gctctgtgcc aacttggaca cgtggtgcat catgtcaccc cagaactgct gcccccagct gcaggagcac agccaacagc cttgcaaaca gtacaacctc tgccacaggc gcagccagga tccgtttggg gacttgctga agaagctcat ggaccaaatc catgaccacc tggagatgcc tgagttgagc cggaaatttg ggacgcaaat gtatgagcag caggtggtga agctgagtga ggctgcggct ttggctgggc ttcaggagca acgggtgtat gcgcttcacc tgaggcgcta caatgacgcg ctgctcatcc atgacaccgt ccgcgccgtg gatgccttgg ctgcgctgca ggatttctat cacagggagc acgtcactaa aacccagatc ctgtgtgccg agcgccggct gctggccctg ttcgatgacc gcaagaatga gctggcccac ttggcaactc atggcccaga gaatccaaaa ctggagatgc tggaaaagat cctgcaaagg cagttcagta gctctaacag ccctcggggt atcatcttca cccgcacccg ccaaagcgca cactccctcc tgctctggct ccagcagcag cagggcctgc agactgtgga catccgggcc cagctactga ttggggctgg gaacagcagc cagagcaccc acatgaccca gagggaccag caagaagtga tccagaagtt ccaagatgga accctgaacc ttctggtggc cacgagtgtg gcggaggagg ggctggacat cccacattgc aatgtggtgg tgcgttatgg gctcttgacc aatgaaatct ccatggtcca ggccaggggc cgtgcccggg ccgatcagag tgtatacgcg tttgtagcaa ctgaaggtag ccgggagctg aagcgggagc tgatcaacga ggcgctggag acgctgatgg agcaggcagt ggctgctgtg cagaaaatgg accaggccga gtaccaggcc aagatccggg atctgcagca ggcagccttg accaagcggg cggcccaggc agcccagcgg gagaaccagc ggcagcagtt cccagtggag cacgtgcagc tactctgcat caactgcatg gtggctgtgg gccatggcag cgacctgcgg aaggtggagg gcacccacca tgtcaatgtg aaccccaact tctcgaacta ctataatgtc tccagggatc ctgtggtcat caacaaagtc ttcaaggact ggaagcctgg gggtgtcatc agctgcagga actgtgggga ggtctggggt ctgcagatga tctacaagtc agtgaagctg ccagtgctca aagtccgcag catgctgctg gagacccctc aggggcggat ccaggccaaa aagtggtccc gcgtgccctt ctccgtgcct gactttgact tcctgcagca ttgtgccgag aacttgtcgg acctctccct ggactga. It is sometimes possible for the material contained within the vial of "DHX58, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.