Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DHX36 cdna clone

DHX36 cDNA Clone

Gene Names
DHX36; G4R1; RHAU; DDX36; MLEL1
Synonyms
DHX36; DHX36 cDNA Clone; DHX36 cdna clone
Ordering
For Research Use Only!
Sequence
atgagttatgactaccatcagaactggggccgtgatgggggtccccgcagctccggtgggggctatggaggggggccagcagggggtcatggaggtaaccgaggctccggaggaggcggcggcggcggagggggtggtcgaggcggcaggggccggcatcccgggcacctgaaaggccgcgaaatcggcatgtggtacgcgaaaaaacaggggcagaagaacaaggaagcggagaggcaagagagagctgtagtacacatggatgaacgacgagaagaacaaattgtacagttactgaattctgttcaagcgaagaatgataaagagtcagaagcacagatatcctggtttgctcctgaggatcatggatacggtactgaagtttctactaagaacacaccatgctcagagaacaaacttgacatccaggaaaagaagttgataaatcaagaaaaaaaaatgtttagaatcaggaacagatcatatattgaccgagattctgagtatctcttgcaagaaaatgaaccagatggaactttagaccaaaaattattggaagatttacaaaagaaaaaaaatgaccttcggtatattgaaatgcagcatttcagagaaaagctgccttcgtatggaatgcaaaaggaattggtaaatttaattgataaccatcaggtaacagtaataagtggtgaaactggttgtggcaaaaccactcaagttactcagttcattttggataactacattgaaagaggaaaaggatctgcttgcagaatagtttgtactcagccaagaagaattagtgccatttcagttgcggaaagagtagctgcagaaagggcagaatcttgtggcagtggtaatagtactggatatcaaattcgtctccagagtcggttgccaaggaaacagggttctatcttatactgtacaacaggaatcatccttcagtggctccagtcagacccgtatttgtccagtgttagtcatatcgtacttgatgaaatccatgaaagaaatctgcagtcagatgttttaatgactgttgttaaagaccttctcaattttcgatctgacttgaaagtaatattgatgagtgcaacattgaatgcagaaaagttttcagaatattttggtaactgtccaatgatacatatacctggttttacctttccggttgtggaatatcttttggaagatgtaattgaaaaaataaggtatgttccagaacaaaaagaacacagatgccagtttaagaggggtttcatgcaagggcatgtaaatagacaagaaaaagaagaaaaagaagcaatatataaagaacgttggccagattatgtaagggaactgcgaagaaggtattctgcaagtactgtagatgttatagaaatgatggaggatgataaagttgatctgaatttgattgttgccctcatccgatacattgttttggaagaagaggatggtgcgatactggtctttctgccaggctgggacaatatcagcactttacatgatctcttgatgtcacaagtaatgtttaaatcagataaatttttaattatacctttacattcactgatgcctacagttaaccagacacaggtgtttaaaagaacccctcctggtgttcggaaaatagtaattgctaccaacattgcggagactagcattaccatagatgatgtcgtttatgtgatagatggaggaaaaataaaagagacgcattttgatactcagaacaataacagtacaatgtccgctgagtgggttagtaaagctaatgccaaacagagaaaaggtcgagctggaagagttcaacctggtcattgctatcatctgtataatggtcttagagcaagtcttctagatgactatcaactgccagaaattttgagaactcctttggaagaactttgtttacaaataaagattttaaggctaggtggaattgcttattttctgagtagattaatggacccaccatcaaatgaggcagtgttactctccataagacacctgatggagctgaacgctttggataaacaagaagaattgacacctcttggagtccacttggcacgattacccgttgagccacatattggaaaaatgattctttttggagcactgttctgctgcttagacccagtactcactattgctgctagtctcagtttcaaagatccatttgtcattccactgggctgggaagaggctaggcgacgtggtttcagatacgaaaaggactattgctgggaatattttctgtcttcaaacacactgcagatgctgcataacatgaaaggacagtttgctgagcatcttcttggagctggatttgtaagcagtagaaatcctaaagatccagaatctaatataaattcagataatgagaagataattaaagctgtcatctgtgctggtttatatcccaaagttgctaaaattcgactaaatttgggtaaaaaaagaaaaatggtaaaagtttacacaaaaaccgatggcctggttgctgttcatcctaaatctgttaatgtggagcaaacagactttcactacaactggcttatctatcacctaaagatgagaacaagcagtatatacttgtatgactgcacagaggtttccccatactgtctcttgttttttggaggtgacatttccatccagaaggataacgatcaggaaactattgctgtagatgagtggattgtatttcagtctccagcaagaattgcccatcttgttaaggaattaagaaaggaactagatattcttctgcaagagaagattgaaagtcctcatcctgtagactggaatgacactaaatccagagactgtgcagtactgtcagctattatagacttgatcaaaacacaggaaaaggcaactcccaggaactttccgccacgattccaggatggatattacagctga
Sequence Length
2940
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
NCBI Official Full Name
Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 36, mRNA
NCBI Official Synonym Full Names
DEAH-box helicase 36
NCBI Official Symbol
DHX36
NCBI Official Synonym Symbols
G4R1; RHAU; DDX36; MLEL1
NCBI Protein Information
ATP-dependent RNA helicase DHX36
UniProt Protein Name
ATP-dependent RNA helicase DHX36
UniProt Gene Name
DHX36
UniProt Synonym Gene Names
DDX36; KIAA1488; MLEL1; RHAU; G4R1
UniProt Entry Name
DHX36_HUMAN

NCBI Description

This gene is a member of the DEAH-box family of RNA-dependent NTPases which are named after the conserved amino acid sequence Asp-Glu-Ala-His in motif II. The protein encoded by this gene has been shown to enhance the deadenylation and decay of mRNAs with 3'-UTR AU-rich elements (ARE-mRNA). The protein has also been shown to resolve into single strands the highly stable tetramolecular DNA configuration (G4) that can form spontaneously in guanine-rich regions of DNA. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

DHX36: Plays a role in degradation and deadenylation of mRNAs containing in their 3'-UTR the consensus ARE sequence element. May function in sex development and spermatogenesis. Belongs to the DEAD box helicase family. DEAH subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Helicase; RNA-binding; EC 3.6.4.13; EC 3.6.4.12

Chromosomal Location of Human Ortholog: 3q25.2

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: ATP-dependent RNA helicase activity; DNA-dependent ATPase activity; double-stranded RNA binding; G-quadruplex DNA binding; histone deacetylase binding; protein binding

Biological Process: ossification; positive regulation of interferon type I production; positive regulation of telomere maintenance; positive regulation of transcription from RNA polymerase II promoter; RNA processing; RNA secondary structure unwinding

Research Articles on DHX36

Similar Products

Product Notes

The DHX36 dhx36 (Catalog #AAA1278832) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagttatg actaccatca gaactggggc cgtgatgggg gtccccgcag ctccggtggg ggctatggag gggggccagc agggggtcat ggaggtaacc gaggctccgg aggaggcggc ggcggcggag ggggtggtcg aggcggcagg ggccggcatc ccgggcacct gaaaggccgc gaaatcggca tgtggtacgc gaaaaaacag gggcagaaga acaaggaagc ggagaggcaa gagagagctg tagtacacat ggatgaacga cgagaagaac aaattgtaca gttactgaat tctgttcaag cgaagaatga taaagagtca gaagcacaga tatcctggtt tgctcctgag gatcatggat acggtactga agtttctact aagaacacac catgctcaga gaacaaactt gacatccagg aaaagaagtt gataaatcaa gaaaaaaaaa tgtttagaat caggaacaga tcatatattg accgagattc tgagtatctc ttgcaagaaa atgaaccaga tggaacttta gaccaaaaat tattggaaga tttacaaaag aaaaaaaatg accttcggta tattgaaatg cagcatttca gagaaaagct gccttcgtat ggaatgcaaa aggaattggt aaatttaatt gataaccatc aggtaacagt aataagtggt gaaactggtt gtggcaaaac cactcaagtt actcagttca ttttggataa ctacattgaa agaggaaaag gatctgcttg cagaatagtt tgtactcagc caagaagaat tagtgccatt tcagttgcgg aaagagtagc tgcagaaagg gcagaatctt gtggcagtgg taatagtact ggatatcaaa ttcgtctcca gagtcggttg ccaaggaaac agggttctat cttatactgt acaacaggaa tcatccttca gtggctccag tcagacccgt atttgtccag tgttagtcat atcgtacttg atgaaatcca tgaaagaaat ctgcagtcag atgttttaat gactgttgtt aaagaccttc tcaattttcg atctgacttg aaagtaatat tgatgagtgc aacattgaat gcagaaaagt tttcagaata ttttggtaac tgtccaatga tacatatacc tggttttacc tttccggttg tggaatatct tttggaagat gtaattgaaa aaataaggta tgttccagaa caaaaagaac acagatgcca gtttaagagg ggtttcatgc aagggcatgt aaatagacaa gaaaaagaag aaaaagaagc aatatataaa gaacgttggc cagattatgt aagggaactg cgaagaaggt attctgcaag tactgtagat gttatagaaa tgatggagga tgataaagtt gatctgaatt tgattgttgc cctcatccga tacattgttt tggaagaaga ggatggtgcg atactggtct ttctgccagg ctgggacaat atcagcactt tacatgatct cttgatgtca caagtaatgt ttaaatcaga taaattttta attatacctt tacattcact gatgcctaca gttaaccaga cacaggtgtt taaaagaacc cctcctggtg ttcggaaaat agtaattgct accaacattg cggagactag cattaccata gatgatgtcg tttatgtgat agatggagga aaaataaaag agacgcattt tgatactcag aacaataaca gtacaatgtc cgctgagtgg gttagtaaag ctaatgccaa acagagaaaa ggtcgagctg gaagagttca acctggtcat tgctatcatc tgtataatgg tcttagagca agtcttctag atgactatca actgccagaa attttgagaa ctcctttgga agaactttgt ttacaaataa agattttaag gctaggtgga attgcttatt ttctgagtag attaatggac ccaccatcaa atgaggcagt gttactctcc ataagacacc tgatggagct gaacgctttg gataaacaag aagaattgac acctcttgga gtccacttgg cacgattacc cgttgagcca catattggaa aaatgattct ttttggagca ctgttctgct gcttagaccc agtactcact attgctgcta gtctcagttt caaagatcca tttgtcattc cactgggctg ggaagaggct aggcgacgtg gtttcagata cgaaaaggac tattgctggg aatattttct gtcttcaaac acactgcaga tgctgcataa catgaaagga cagtttgctg agcatcttct tggagctgga tttgtaagca gtagaaatcc taaagatcca gaatctaata taaattcaga taatgagaag ataattaaag ctgtcatctg tgctggttta tatcccaaag ttgctaaaat tcgactaaat ttgggtaaaa aaagaaaaat ggtaaaagtt tacacaaaaa ccgatggcct ggttgctgtt catcctaaat ctgttaatgt ggagcaaaca gactttcact acaactggct tatctatcac ctaaagatga gaacaagcag tatatacttg tatgactgca cagaggtttc cccatactgt ctcttgtttt ttggaggtga catttccatc cagaaggata acgatcagga aactattgct gtagatgagt ggattgtatt tcagtctcca gcaagaattg cccatcttgt taaggaatta agaaaggaac tagatattct tctgcaagag aagattgaaa gtcctcatcc tgtagactgg aatgacacta aatccagaga ctgtgcagta ctgtcagcta ttatagactt gatcaaaaca caggaaaagg caactcccag gaactttccg ccacgattcc aggatggata ttacagctga. It is sometimes possible for the material contained within the vial of "DHX36, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.