Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DHX33 cdna clone

DHX33 cDNA Clone

Gene Names
DHX33; DDX33
Synonyms
DHX33; DHX33 cDNA Clone; DHX33 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggtgattgtgatgtcagctacgatggatgtggacctgttctctcagtatttcaatggcgcccccgtcctctacctagagggtcggcagcatccgatccaggtgttttacaccaaacagcctcagaatgattacctgcacgccgcgcttgtctccgtcttccagatccaccaggaagccccttcttcacaggacatcctggtgttcctcactgggcaggaggagatcgaagccatgagcaagacgtgccgagacattgcaaagcacctcccagacggctgccctgcgatgctggtccttcctctgtacgcctccctgccctatgcacagcagctccgagtcttccaaggggccccaaagggctatcgcaaagtgatcatttcaaccaacatcgctgaaacctccataaccattacaggaataaaatatgtagttgacacgggcatggttaaagcaaagaagtataaccctgacagtggtcttgaggtgttagcagtgcagcgggtatcgaagacgcaggcttggcagcgcacagggagggctggcagagaggacagtggcatctgctaccggctctacacggaggacgagtttgagaagtttgataagatgaccgtgccagagatccagaggtgtaacctggccagtgtgatgcttcagcttctagcaatgaaagtcccaaatgtgctcacctttgacttcatgtcgaagccatctccagatcacattcaggcggccattgcccaactggacctgttaggtgctcttgaacataaggatgaccagcttaccctgactccaatgggaagaaagatggcagcatttcctttagaacccaaatttgccaaaaccatcctcatgtcccccaaattccactgtacagaggagatcctgaccattgtctccctgctgtctgtggacagcgtcctccacaaccctccttcccggcgagaggaagtgcaaggggtccgcaagaagttcatatccagcgagggggatcacatgaccctgctcaatatctatcggaccttcaaaaacctaggcggaaataaggattggtgcaaagagaattttgtcaacagcaagaatatgacgctggtagcagaagtcagagcacagctgagggacatctgcttaaagatgtcaatgccaatcgcatcatcccgaggagacgtggagagtgtccgccgctgcctggctcacagcctcttcatgagcaccgccgagcttcagccagatggcacctatgccaccacggacacccaccagccagtggccatccacccgtcgtctgtcctcttccactgcaagccggcctgcgtcgtgtacactgagctgctctacaccaacaagtgctacatgcgggacctctgcgtcatagatgcacagtggctgtacgaggctgcccctgagtactttaggaggaagctgagaaccgccagaaactga
Sequence Length
1452
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,393 Da
NCBI Official Full Name
Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 33, mRNA
NCBI Official Synonym Full Names
DEAH-box helicase 33
NCBI Official Symbol
DHX33
NCBI Official Synonym Symbols
DDX33
NCBI Protein Information
putative ATP-dependent RNA helicase DHX33
UniProt Protein Name
Putative ATP-dependent RNA helicase DHX33
UniProt Gene Name
DHX33
UniProt Synonym Gene Names
DDX33
UniProt Entry Name
DHX33_HUMAN

NCBI Description

This gene encodes a member of the DEAD box protein family. The DEAD box proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]

Uniprot Description

DHX33: Stimulates RNA polymerase I transcription of the 47S precursor rRNA. Associates with ribosomal DNA (rDNA) loci where it is involved in POLR1A recruitment. Important element of nucleolar organization. Belongs to the DEAD box helicase family. DEAH subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.6.4.13; Nucleolus; Helicase

Chromosomal Location of Human Ortholog: 17p13.2

Cellular Component: cytoplasm; nucleolus; nucleoplasm

Molecular Function: ATP-dependent RNA helicase activity; rDNA binding

Biological Process: positive regulation of transcription from RNA polymerase I promoter; RNA processing

Research Articles on DHX33

Similar Products

Product Notes

The DHX33 dhx33 (Catalog #AAA1273828) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggtga ttgtgatgtc agctacgatg gatgtggacc tgttctctca gtatttcaat ggcgcccccg tcctctacct agagggtcgg cagcatccga tccaggtgtt ttacaccaaa cagcctcaga atgattacct gcacgccgcg cttgtctccg tcttccagat ccaccaggaa gccccttctt cacaggacat cctggtgttc ctcactgggc aggaggagat cgaagccatg agcaagacgt gccgagacat tgcaaagcac ctcccagacg gctgccctgc gatgctggtc cttcctctgt acgcctccct gccctatgca cagcagctcc gagtcttcca aggggcccca aagggctatc gcaaagtgat catttcaacc aacatcgctg aaacctccat aaccattaca ggaataaaat atgtagttga cacgggcatg gttaaagcaa agaagtataa ccctgacagt ggtcttgagg tgttagcagt gcagcgggta tcgaagacgc aggcttggca gcgcacaggg agggctggca gagaggacag tggcatctgc taccggctct acacggagga cgagtttgag aagtttgata agatgaccgt gccagagatc cagaggtgta acctggccag tgtgatgctt cagcttctag caatgaaagt cccaaatgtg ctcacctttg acttcatgtc gaagccatct ccagatcaca ttcaggcggc cattgcccaa ctggacctgt taggtgctct tgaacataag gatgaccagc ttaccctgac tccaatggga agaaagatgg cagcatttcc tttagaaccc aaatttgcca aaaccatcct catgtccccc aaattccact gtacagagga gatcctgacc attgtctccc tgctgtctgt ggacagcgtc ctccacaacc ctccttcccg gcgagaggaa gtgcaagggg tccgcaagaa gttcatatcc agcgaggggg atcacatgac cctgctcaat atctatcgga ccttcaaaaa cctaggcgga aataaggatt ggtgcaaaga gaattttgtc aacagcaaga atatgacgct ggtagcagaa gtcagagcac agctgaggga catctgctta aagatgtcaa tgccaatcgc atcatcccga ggagacgtgg agagtgtccg ccgctgcctg gctcacagcc tcttcatgag caccgccgag cttcagccag atggcaccta tgccaccacg gacacccacc agccagtggc catccacccg tcgtctgtcc tcttccactg caagccggcc tgcgtcgtgt acactgagct gctctacacc aacaagtgct acatgcggga cctctgcgtc atagatgcac agtggctgta cgaggctgcc cctgagtact ttaggaggaa gctgagaacc gccagaaact ga. It is sometimes possible for the material contained within the vial of "DHX33, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.