Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DHX32 cdna clone

DHX32 cDNA Clone

Gene Names
DHX32; DDX32; DHLP1
Synonyms
DHX32; DHX32 cDNA Clone; DHX32 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagaagaagggctggagtgtccaaactcttcctctgaaaaacgctattttcctgaatccctggattccagcgatggggatgaggaagaggttttggcctgtgaggatttggaacttaacccctttgatggattgccatattcatcacgttattataaacttctgaaagaaagagaagatcttcctatatggaaagaaaaatactcctttatggagaacctgcttcaaaatcaaatcgtgattgtttcaggagatgctaaatgtggtaagagcgctcaggttcctcagtggtgtgctgaatattgtctttccatccactaccagcacgggggcgtgatatgcacacaggtccacaagcagactgtggtccagctcgccctgcgggtggcggatgaaatggatgttaacattggtcatgaggttggctacgtgatccctttcgagaactgctgtaccaacgaaacaatcctgaggtattgtactgatgatatgctgcaaagagaaatgatgtccaatccttttttgggtagctatggggtcatcatcttagatgatattcatgaaagaagcattgcaactgatgtgttacttggacttcttaaagatgttttactagcaagaccagaactgaagctcataattaactcctcacctcacctgatcagcaaactcaattcttattatggaaacgtgcctgtcatagaagtgaaaaataaacaccctgtggaggttgtgtaccttagtgaggctcaaaaggattcttttgagtctattttacgccttatctttgaaattcaccactcgggtgagaaaggtgacattgtagtctttctggcctgtgaacaagatattgagaaagtctgtgaaactgtctatcaaggatctaacctaaacccagatcttggagaactggtggttgttcctttgtatccaaaagagaaatgttcattgttcaagccactcgatgaaacagaaaaaagatgccaagtttatcaaagaagagtggtgttaactactagctctggagagtttttgatctggagcaactcagtcagatttgttatcgatgtgggtgtggaaagaagaaaggtgtacaacccgagaataagagcaaactcgctcgtcatgcagcccatcagccagagccaggcagagatacgcaagcagattcttggctcatcttcttcaggaaaatttttctgcctgtacactgaagaatttgcctccaaagacatgacgccactgaagccagcagaaatgcaggaagccaacctaacaagcatggtgctttttatgaagaggatagacattgcgggcctaggccactgtgacttcatgaacagaccagcaccagaaagtttgatgcaggcattggaagacttagattatctggcagcactggataatgatggaaatctttctgaatttggaatcatcatgtcagagtttcctcttgatccacaactctcgaagtctatcttagcgtcctgtgaatttgactgtgtagatgaagtgctaacaatcgcggccatggtaacagctccaaattgcttttcacatgtgccacatggagctgaagaggctgccttgacttgttggaagacatttttacatcccgaaggagatcactttaccctcatcagcatttacaaggcttaccaagacacaactctgaattctagcagtgagtactgtgtggaaaagtggtgtcgtgattacttcctcaactgttcagcactcagaatggcagatgttattcgagctgaactcttagaaattatcaagcgaatcgagcttccctatgcagaacctgcttttggctccaaggaaaacactctaaacataaagaaagctcttctgtccggttactttatgcagattgctcgggatgttgatggatcaggtaactacttaatgctgacacataagcaggttgctcagctgcatcccctgtctggttactcaatcaccaagaagatgccagagtgggtcctcttccataaattcagcatttctgagaacaactacatcaggattacctcagaaatctctcctgaactatttatgcagctggtaccacaatactatttcagtaatctgcctcctagtgaaagtaaggacattctacagcaagtagtggatcacctatcccctgtgtcaacaatgaataaggaacagcaaatgtgtgagacgtgccctgaaactgaacagagatgcactctccagtga
Sequence Length
2232
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
75,088 Da
NCBI Official Full Name
Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 32, mRNA
NCBI Official Synonym Full Names
DEAH-box helicase 32 (putative)
NCBI Official Symbol
DHX32
NCBI Official Synonym Symbols
DDX32; DHLP1
NCBI Protein Information
putative pre-mRNA-splicing factor ATP-dependent RNA helicase DHX32
UniProt Protein Name
Putative pre-mRNA-splicing factor ATP-dependent RNA helicase DHX32
UniProt Gene Name
DHX32
UniProt Synonym Gene Names
DDX32; DHLP1
UniProt Entry Name
DHX32_HUMAN

NCBI Description

DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates 2 transcript variants, but the full length nature of one of the variants has not been defined. [provided by RefSeq, Jul 2008]

Uniprot Description

DHX32: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates 2 transcript variants, but the full length nature of one of the variants has not been defined. [provided by RefSeq, Jul 2008]

Protein type: EC 3.6.4.13; Helicase

Chromosomal Location of Human Ortholog: 10q26.2

Cellular Component: cytoplasm; spliceosome

Molecular Function: ATP-dependent RNA helicase activity; protein binding

Biological Process: nuclear mRNA splicing, via spliceosome

Research Articles on DHX32

Similar Products

Product Notes

The DHX32 dhx32 (Catalog #AAA1270660) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagaag aagggctgga gtgtccaaac tcttcctctg aaaaacgcta ttttcctgaa tccctggatt ccagcgatgg ggatgaggaa gaggttttgg cctgtgagga tttggaactt aacccctttg atggattgcc atattcatca cgttattata aacttctgaa agaaagagaa gatcttccta tatggaaaga aaaatactcc tttatggaga acctgcttca aaatcaaatc gtgattgttt caggagatgc taaatgtggt aagagcgctc aggttcctca gtggtgtgct gaatattgtc tttccatcca ctaccagcac gggggcgtga tatgcacaca ggtccacaag cagactgtgg tccagctcgc cctgcgggtg gcggatgaaa tggatgttaa cattggtcat gaggttggct acgtgatccc tttcgagaac tgctgtacca acgaaacaat cctgaggtat tgtactgatg atatgctgca aagagaaatg atgtccaatc cttttttggg tagctatggg gtcatcatct tagatgatat tcatgaaaga agcattgcaa ctgatgtgtt acttggactt cttaaagatg ttttactagc aagaccagaa ctgaagctca taattaactc ctcacctcac ctgatcagca aactcaattc ttattatgga aacgtgcctg tcatagaagt gaaaaataaa caccctgtgg aggttgtgta ccttagtgag gctcaaaagg attcttttga gtctatttta cgccttatct ttgaaattca ccactcgggt gagaaaggtg acattgtagt ctttctggcc tgtgaacaag atattgagaa agtctgtgaa actgtctatc aaggatctaa cctaaaccca gatcttggag aactggtggt tgttcctttg tatccaaaag agaaatgttc attgttcaag ccactcgatg aaacagaaaa aagatgccaa gtttatcaaa gaagagtggt gttaactact agctctggag agtttttgat ctggagcaac tcagtcagat ttgttatcga tgtgggtgtg gaaagaagaa aggtgtacaa cccgagaata agagcaaact cgctcgtcat gcagcccatc agccagagcc aggcagagat acgcaagcag attcttggct catcttcttc aggaaaattt ttctgcctgt acactgaaga atttgcctcc aaagacatga cgccactgaa gccagcagaa atgcaggaag ccaacctaac aagcatggtg ctttttatga agaggataga cattgcgggc ctaggccact gtgacttcat gaacagacca gcaccagaaa gtttgatgca ggcattggaa gacttagatt atctggcagc actggataat gatggaaatc tttctgaatt tggaatcatc atgtcagagt ttcctcttga tccacaactc tcgaagtcta tcttagcgtc ctgtgaattt gactgtgtag atgaagtgct aacaatcgcg gccatggtaa cagctccaaa ttgcttttca catgtgccac atggagctga agaggctgcc ttgacttgtt ggaagacatt tttacatccc gaaggagatc actttaccct catcagcatt tacaaggctt accaagacac aactctgaat tctagcagtg agtactgtgt ggaaaagtgg tgtcgtgatt acttcctcaa ctgttcagca ctcagaatgg cagatgttat tcgagctgaa ctcttagaaa ttatcaagcg aatcgagctt ccctatgcag aacctgcttt tggctccaag gaaaacactc taaacataaa gaaagctctt ctgtccggtt actttatgca gattgctcgg gatgttgatg gatcaggtaa ctacttaatg ctgacacata agcaggttgc tcagctgcat cccctgtctg gttactcaat caccaagaag atgccagagt gggtcctctt ccataaattc agcatttctg agaacaacta catcaggatt acctcagaaa tctctcctga actatttatg cagctggtac cacaatacta tttcagtaat ctgcctccta gtgaaagtaa ggacattcta cagcaagtag tggatcacct atcccctgtg tcaacaatga ataaggaaca gcaaatgtgt gagacgtgcc ctgaaactga acagagatgc actctccagt ga. It is sometimes possible for the material contained within the vial of "DHX32, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.