Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DHX15 cdna clone

DHX15 cDNA Clone

Gene Names
DHX15; DBP1; HRH2; DDX15; PRP43; PRPF43; PrPp43p
Synonyms
DHX15; DHX15 cDNA Clone; DHX15 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccaagcggcaccggttggacctaggggaggattacccctctggcaagaagcgtgcggggaccgatgggaaggatcgagatcgagaccgggatcgtgaagatcggtctaaagatcgagaccgagaacgtgatagaggagatagagagcgagagagggagaaagaaaaggagaaggagttgcgagcttcaacaaatgctatgcttatcagtgctggattaccacctttgaaagcttcccattcagctcactcaacccactcagcacattcaacgcattcaacacattctgctcattcaacgcatgccggacatgcaggtcacacgtcacttccacagtgcattaatccgttcaccaacttaccccatactcctcgatactatgatattctaaagaaacgtcttcagctccctgtttgggaatacaaggataggtttacagatattctggttagacatcagtcctttgtactggttggtgagactgggtctggtaaaacaacacagattccacagtggtgtgtggagtacatgcgatcattaccaggacccaagagaggagttgcctgtacccaacccaggagagtggctgcaatgagtgtggctcagagagttgctgatgagatggatgtgatgttgggccaggaagttggttactccattcgatttgaagactgcagtagtgcaaaaaccattcttaagtatatgactgatgggatgttacttcgtgaagctatgaatgatcccctcctggagcgttatggtgtaataattcttgatgaggctcatgagaggacactggctacagatattctaatgggtgttctgaaggaagttgtaagacagagatcagatttaaaggttatagttatgagcgctactctagatgcaggaaaattccagatttactttgataactgtcctctcctaactattcctgggcgtacacatcctgttgagatcttctatactccagaaccagagagagattatcttgaagcagcaattcgaacagttatccagattcatatgtgtgaagaggaagagggagatcttcttcttttcttaactggtcaagaggaaattgatgaagcctgtaagagaataaagcgtgaagttgatgatttgggccctgaagttggtgacattaaaatcattccattgtattctacacttccacctcagcagcagcaacgcatttttgagcctccacctcccaaaaaacagaatggagcaattggaagaaaggtagttgtgtcaactaacatagcagagacgtctttgacaatagatggtgtggtgtttgtgattgatcctggatttgcgaaacagaaggtctacaatcctcgaatcagagttgagtcccttttggtgacagctattagtaaagcttcagctcagcaaagggctggtcgagctggacgtaccagacctggaaaatgcttcagactttacacagagaaagcttataaaacagaaatgcaggataacacctatcctgagattttgcgttctaatttaggatcagttgtgttacaattgaagaaacttggtattgatgacttggtacattttgattttatggatccaccagctcctgaaactctgatgagagccctggaacttttgaattacctggctgctttaaatgatgatggagatctgactgaattgggatccatgatggcagagtttcctctagatccacagctcgcaaaaatggttattgcaagttgtgactacaactgttctaatgaggtcctatctattactgctatgttgtcagtcccacagtgttttgttcgccccacggaggccaagaaagccgcagatgaggccaagatgagatttgcccacatagatggagatcatctgacactgctgaacgtctaccatgcttttaaacaaaatcatgaatcggttcagtggtgttatgacaacttcattaactacaggtccctgatgtccgcagacaatgtacgccagcagctatctcgaattatggacagatttaatttgcctcgtcgaagtactgactttacaagcagggactattatattaatataagaaaagctttggttactgggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagataaccaggtggttcagttgcatccctctactgttcttgaccacaaacctgaatgggtgctttataatgagtttgttctaacaacaaagaattacatccggacatgtacagatatcaagccagaatggttggtgaaaattgcccctcaatattatgacatgagcaatttcccacagtgtgaagcaaagagacagttggaccgcatcattgccaaacttcaatccaaggaatattcacagtactga
Sequence Length
2388
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,933 Da
NCBI Official Full Name
Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 15, mRNA
NCBI Official Synonym Full Names
DEAH-box helicase 15
NCBI Official Symbol
DHX15
NCBI Official Synonym Symbols
DBP1; HRH2; DDX15; PRP43; PRPF43; PrPp43p
NCBI Protein Information
pre-mRNA-splicing factor ATP-dependent RNA helicase DHX15
UniProt Protein Name
Pre-mRNA-splicing factor ATP-dependent RNA helicase DHX15
UniProt Gene Name
DHX15
UniProt Synonym Gene Names
DBP1; DDX15
UniProt Entry Name
DHX15_HUMAN

NCBI Description

The protein encoded by this gene is a putative ATP-dependent RNA helicase implicated in pre-mRNA splicing. [provided by RefSeq, Jul 2008]

Uniprot Description

DDX15: Pre-mRNA processing factor involved in disassembly of spliceosomes after the release of mature mRNA. Belongs to the DEAD box helicase family. DEAH subfamily. DDX15/PRP43 sub-subfamily.

Protein type: RNA-binding; EC 3.6.4.13; RNA splicing; Spliceosome; Nucleolus; Helicase

Chromosomal Location of Human Ortholog: 4p15.3

Cellular Component: cytoplasm; nucleus; U12-dependent spliceosome

Molecular Function: ATP-dependent RNA helicase activity; double-stranded RNA binding; protein binding; RNA helicase activity

Biological Process: mRNA processing; nuclear mRNA splicing, via spliceosome; RNA splicing

Research Articles on DHX15

Similar Products

Product Notes

The DHX15 dhx15 (Catalog #AAA1272712) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccaagc ggcaccggtt ggacctaggg gaggattacc cctctggcaa gaagcgtgcg gggaccgatg ggaaggatcg agatcgagac cgggatcgtg aagatcggtc taaagatcga gaccgagaac gtgatagagg agatagagag cgagagaggg agaaagaaaa ggagaaggag ttgcgagctt caacaaatgc tatgcttatc agtgctggat taccaccttt gaaagcttcc cattcagctc actcaaccca ctcagcacat tcaacgcatt caacacattc tgctcattca acgcatgccg gacatgcagg tcacacgtca cttccacagt gcattaatcc gttcaccaac ttaccccata ctcctcgata ctatgatatt ctaaagaaac gtcttcagct ccctgtttgg gaatacaagg ataggtttac agatattctg gttagacatc agtcctttgt actggttggt gagactgggt ctggtaaaac aacacagatt ccacagtggt gtgtggagta catgcgatca ttaccaggac ccaagagagg agttgcctgt acccaaccca ggagagtggc tgcaatgagt gtggctcaga gagttgctga tgagatggat gtgatgttgg gccaggaagt tggttactcc attcgatttg aagactgcag tagtgcaaaa accattctta agtatatgac tgatgggatg ttacttcgtg aagctatgaa tgatcccctc ctggagcgtt atggtgtaat aattcttgat gaggctcatg agaggacact ggctacagat attctaatgg gtgttctgaa ggaagttgta agacagagat cagatttaaa ggttatagtt atgagcgcta ctctagatgc aggaaaattc cagatttact ttgataactg tcctctccta actattcctg ggcgtacaca tcctgttgag atcttctata ctccagaacc agagagagat tatcttgaag cagcaattcg aacagttatc cagattcata tgtgtgaaga ggaagaggga gatcttcttc ttttcttaac tggtcaagag gaaattgatg aagcctgtaa gagaataaag cgtgaagttg atgatttggg ccctgaagtt ggtgacatta aaatcattcc attgtattct acacttccac ctcagcagca gcaacgcatt tttgagcctc cacctcccaa aaaacagaat ggagcaattg gaagaaaggt agttgtgtca actaacatag cagagacgtc tttgacaata gatggtgtgg tgtttgtgat tgatcctgga tttgcgaaac agaaggtcta caatcctcga atcagagttg agtccctttt ggtgacagct attagtaaag cttcagctca gcaaagggct ggtcgagctg gacgtaccag acctggaaaa tgcttcagac tttacacaga gaaagcttat aaaacagaaa tgcaggataa cacctatcct gagattttgc gttctaattt aggatcagtt gtgttacaat tgaagaaact tggtattgat gacttggtac attttgattt tatggatcca ccagctcctg aaactctgat gagagccctg gaacttttga attacctggc tgctttaaat gatgatggag atctgactga attgggatcc atgatggcag agtttcctct agatccacag ctcgcaaaaa tggttattgc aagttgtgac tacaactgtt ctaatgaggt cctatctatt actgctatgt tgtcagtccc acagtgtttt gttcgcccca cggaggccaa gaaagccgca gatgaggcca agatgagatt tgcccacata gatggagatc atctgacact gctgaacgtc taccatgctt ttaaacaaaa tcatgaatcg gttcagtggt gttatgacaa cttcattaac tacaggtccc tgatgtccgc agacaatgta cgccagcagc tatctcgaat tatggacaga tttaatttgc ctcgtcgaag tactgacttt acaagcaggg actattatat taatataaga aaagctttgg ttactgggta ttttatgcag gtggcacatt tagaacgaac agggcattac ttaactgtga aagataacca ggtggttcag ttgcatccct ctactgttct tgaccacaaa cctgaatggg tgctttataa tgagtttgtt ctaacaacaa agaattacat ccggacatgt acagatatca agccagaatg gttggtgaaa attgcccctc aatattatga catgagcaat ttcccacagt gtgaagcaaa gagacagttg gaccgcatca ttgccaaact tcaatccaag gaatattcac agtactga. It is sometimes possible for the material contained within the vial of "DHX15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.