Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DHFR cdna clone

DHFR cDNA Clone

Gene Names
DHFR; DYR; DHFRP1
Synonyms
DHFR; DHFR cDNA Clone; DHFR cdna clone
Ordering
For Research Use Only!
Sequence
atggttggttcgctaaactgcatcgtcgctgtgtcccagaacatgggcatcggcaagaacggggacctgccctggccaccgctcaggaatgaattcagatatttccagagaatgaccacaacctcttcagtagaaggtaaacagaatctggtgattatgggtaagaagacctggttctccattcctgagaagaatcgacctttaaagggtagaattaatttagttctcagcagagaactcaaggaacctccacaaggagctcattttctttccagaagtctagatgatgccttaaaacttactgaacaaccagaattagcaaataaagtagacatggtctggatagttggtggcagttctgtttataaggaagccatgaatcacccaggccatcttaaactatttgtgacaaggatcatgcaagactttgaaagtgacacgttttttccagaaattgatttggagaaatataaacttctgccagaatacccaggtgttctctctgatgtccaggaggagaaaggcattaagtacaaatttgaagtatatgagaagaatgattaa
Sequence Length
564
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,672 Da
NCBI Official Full Name
Homo sapiens dihydrofolate reductase, mRNA
NCBI Official Synonym Full Names
dihydrofolate reductase
NCBI Official Symbol
DHFR
NCBI Official Synonym Symbols
DYR; DHFRP1
NCBI Protein Information
dihydrofolate reductase
UniProt Protein Name
Dihydrofolate reductase
UniProt Gene Name
DHFR
UniProt Entry Name
DYR_HUMAN

NCBI Description

Dihydrofolate reductase converts dihydrofolate into tetrahydrofolate, a methyl group shuttle required for the de novo synthesis of purines, thymidylic acid, and certain amino acids. While the functional dihydrofolate reductase gene has been mapped to chromosome 5, multiple intronless processed pseudogenes or dihydrofolate reductase-like genes have been identified on separate chromosomes. Dihydrofolate reductase deficiency has been linked to megaloblastic anemia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]

Uniprot Description

DHFR: Key enzyme in folate metabolism. Contributes to the de novo mitochondrial thymidylate biosynthesis pathway. Catalyzes an essential reaction for de novo glycine and purine synthesis, and for DNA precursor synthesis. Binds its own mRNA and that of DHFRL1. Defects in DHFR are the cause of megaloblastic anemia due to dihydrofolate reductase deficiency (DHFRD). DHFRD is an inborn error of metabolism, characterized by megaloblastic anemia and/or pancytopenia, severe cerebral folate deficiency, and cerebral tetrahydrobiopterin deficiency. Clinical features include variable neurologic symptoms, ranging from severe developmental delay and generalized seizures in infancy, to childhood absence epilepsy with learning difficulties, to lack of symptoms. Belongs to the dihydrofolate reductase family.

Protein type: Cofactor and Vitamin Metabolism - folate biosynthesis; Cofactor and Vitamin Metabolism - one carbon pool by folate; EC 1.5.1.3; Oxidoreductase

Chromosomal Location of Human Ortholog: 5q14.1

Cellular Component: cytosol; nucleoplasm

Molecular Function: dihydrofolate reductase activity; drug binding; folate reductase activity; folic acid binding; methotrexate binding; mRNA binding

Biological Process: axon regeneration; dihydrofolate metabolic process; folic acid metabolic process; G1/S transition of mitotic cell cycle; G1/S-specific transcription in mitotic cell cycle; positive regulation of nitric-oxide synthase activity; response to methotrexate; tetrahydrobiopterin biosynthetic process; tetrahydrofolate biosynthetic process; tetrahydrofolate metabolic process

Disease: Megaloblastic Anemia Due To Dihydrofolate Reductase Deficiency

Research Articles on DHFR

Similar Products

Product Notes

The DHFR dhfr (Catalog #AAA1272688) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggttggtt cgctaaactg catcgtcgct gtgtcccaga acatgggcat cggcaagaac ggggacctgc cctggccacc gctcaggaat gaattcagat atttccagag aatgaccaca acctcttcag tagaaggtaa acagaatctg gtgattatgg gtaagaagac ctggttctcc attcctgaga agaatcgacc tttaaagggt agaattaatt tagttctcag cagagaactc aaggaacctc cacaaggagc tcattttctt tccagaagtc tagatgatgc cttaaaactt actgaacaac cagaattagc aaataaagta gacatggtct ggatagttgg tggcagttct gtttataagg aagccatgaa tcacccaggc catcttaaac tatttgtgac aaggatcatg caagactttg aaagtgacac gttttttcca gaaattgatt tggagaaata taaacttctg ccagaatacc caggtgttct ctctgatgtc caggaggaga aaggcattaa gtacaaattt gaagtatatg agaagaatga ttaa. It is sometimes possible for the material contained within the vial of "DHFR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.