Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX55 cdna clone

DDX55 cDNA Clone

Synonyms
DDX55; DDX55 cDNA Clone; DDX55 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagccccagagaaacacagcggaccttctgccaaaactcaagtccatggccctggctgacagagctgtgtttgaaaagggcatgaaagcttttgtgtcatatgtccaagcttatgcaaagcatgaatgcaacctgattttcagattaaaggatcttgattttgccagccttgctcgaggttttgccctgctgaggatgcccaagatgccagaattgagagggaagcagtttccagattttgtgcccgtggacgttaataccgacacgattccatttaaagataaaatcagagaaaagcagaggcagaaactcctggagcaacaaagaagagagaaaacagaaaatgaagggagaagaaaattcataaaaaataaagcttggtcaaagcagaaggccaaaaaagaaaagaagaaaaaaatgaatgagaaaaggaaaagggaagagggttctgatattgaagatgaggacatggaagaacttcttaatgacacaagactcttgaaaaaacttaagaaaggcaaaataactgaagaagaatttgagaagggcttgttgacaactggcaaaagaacaatcaagacagtggatttagggatctcagatttggaagatgactgctaa
Sequence Length
624
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,294 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 55, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 55
NCBI Official Symbol
DDX55
NCBI Protein Information
ATP-dependent RNA helicase DDX55
UniProt Protein Name
ATP-dependent RNA helicase DDX55
UniProt Gene Name
DDX55
UniProt Synonym Gene Names
KIAA1595
UniProt Entry Name
DDX55_HUMAN

NCBI Description

This gene encodes a member of protein family containing a characteristic Asp-Glu-Ala-Asp (DEAD) motif. These proteins are putative RNA helicases, and may be involved in a range of nuclear processes including translational initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Multiple alternatively spliced transcript variants have been found for this gene. Pseudogenes have been identified on chromosomes 1 and 12. [provided by RefSeq, Feb 2016]

Uniprot Description

DDX55: Probable ATP-binding RNA helicase. Belongs to the DEAD box helicase family. DDX55/SPB4 subfamily.

Protein type: EC 3.6.4.13; Helicase; RNA-binding

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: membrane

Molecular Function: ATP-dependent RNA helicase activity; protein binding

Biological Process: RNA secondary structure unwinding

Similar Products

Product Notes

The DDX55 ddx55 (Catalog #AAA1272370) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcccc agagaaacac agcggacctt ctgccaaaac tcaagtccat ggccctggct gacagagctg tgtttgaaaa gggcatgaaa gcttttgtgt catatgtcca agcttatgca aagcatgaat gcaacctgat tttcagatta aaggatcttg attttgccag ccttgctcga ggttttgccc tgctgaggat gcccaagatg ccagaattga gagggaagca gtttccagat tttgtgcccg tggacgttaa taccgacacg attccattta aagataaaat cagagaaaag cagaggcaga aactcctgga gcaacaaaga agagagaaaa cagaaaatga agggagaaga aaattcataa aaaataaagc ttggtcaaag cagaaggcca aaaaagaaaa gaagaaaaaa atgaatgaga aaaggaaaag ggaagagggt tctgatattg aagatgagga catggaagaa cttcttaatg acacaagact cttgaaaaaa cttaagaaag gcaaaataac tgaagaagaa tttgagaagg gcttgttgac aactggcaaa agaacaatca agacagtgga tttagggatc tcagatttgg aagatgactg ctaa. It is sometimes possible for the material contained within the vial of "DDX55, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.