Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX5 cdna clone

DDX5 cDNA Clone

Gene Names
DDX5; p68; HLR1; G17P1; HUMP68
Synonyms
DDX5; DDX5 cDNA Clone; DDX5 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgggttattcgagtgaccgagaccgcggccgggaccgagggtttggtgcacctcgatttggaggaagtagggcagggcccttatctggaaagaagtttggaaaccctggggagaaattagttaaaaagaagtggaatcttgatgagctgcctaaatttgagaagaatttttatcaagagcaccctgatttggctaggcgcacagcacaagaggtggaaacatacagaagaagcaaggaaattacagttagaggtcacaactgcccgaagccagttctaaatttttatgaagccaatttccctgcaaatgtcatggatgttattgcaagacagaatttcactgaacccactgctattcaagctcagggatggccagttgctctaagtggattggatatggttggagtggcacagactggatctgggaaaacattgtcttatttgcttcctgccattgtccacatcaatcatcagccattcctagagagaggcgatgggcctatttgtttggtgctggcaccaactcgggaactggcccaacaggtgcagcaagtagctgctgaatattgtagagcatgtcgcttgaagtctacttgtatctacggtggtgctcctaagggaccacaaatacgtgatttggagagaggtgtggaaatctgtattgcaacacctggaagactgattgactttttagagtgtggaaaaaccaatctgagaagaacaacctaccttgtccttgatgaagcagatagaatgcttgatatgggctttgaaccccaaataaggaagattgtggatcaaataagacctgataggcaaactctaatgtggagtgcgacttggccaaaagaagtaagacagcttgctgaagatttcctgaaagactatattcatataaacattggtgcacttgaactgagtgcaaaccacaacattcttcagattgtggatgtgtgtcatgacgtagaaaaggatgaaaaacttattcgtctaatggaagagatcatgagtgagaaggagaataaaaccattgtttttgtggaaaccaaaagaagatgtgatgagcttaccagaaaaatgaggagagatgggtggcctgccatgggtatccatggtgacaagagtcaacaagagcgtgactgggttctaaatgaattcaaacatggaaaagctcctattctgattgctacagatgtggcctccagagggctagatgtggaagatgtgaaatttgtcatcaattatgactaccctaactcctcagaggattatattcatcgaattggaagaactgctcgcagtaccaaaacaggcacagcatacactttctttacacctaataacataaagcaagtgagcgaccttatctctgtgcttcgtgaagctaatcaagcaattaatcccaagttgcttcagttggtcgaagacagaggttcaggtcgttccaggggtagaggaggcatgaaggatgaccgtcgggacagatactctgcgggcaaaaggggtggatttaatacctttagagacagggaaaattatgacagaggttactctagcctgcttaaaagagattttggggcaaaaactcagaatggtgtttacagtgctgcaaattacaccaatgggagctttggaagtaattttgtgtctgctggtatacagaccagttttaggactggtaatccaacagggacttaccagaatggttatgatagcactcagcaatacggaagtaatgttccaaatatgcacaatggtatgaaccaacaggcatatgcatatcctgctactgcagctgcacctatgattggttatccaatgccaacaggatattcccaataa
Sequence Length
1845
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,148 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 5, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 5
NCBI Official Symbol
DDX5
NCBI Official Synonym Symbols
p68; HLR1; G17P1; HUMP68
NCBI Protein Information
probable ATP-dependent RNA helicase DDX5
UniProt Protein Name
Probable ATP-dependent RNA helicase DDX5
UniProt Gene Name
DDX5
UniProt Synonym Gene Names
G17P1; HELR; HLR1
UniProt Entry Name
DDX5_HUMAN

NCBI Description

DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Uniprot Description

DDX5: a putative ATP-dependent RNA helicase. A proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. The rate of ATP hydrolysis is highly stimulated by single-stranded RNA. Belongs to the DEAD box helicase family. DDX5/DDX17 subfamily. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly.

Protein type: EC 3.6.4.13; Helicase; Spliceosome; Nuclear receptor co-regulator; RNA-binding; RNA splicing; Nucleolus

Chromosomal Location of Human Ortholog: 17q21

Cellular Component: extracellular matrix; membrane; nucleolus; nucleoplasm; nucleus; ribonucleoprotein complex

Molecular Function: androgen receptor binding; ATP-dependent RNA helicase activity; estrogen receptor binding; protein binding; RNA helicase activity; transcription coactivator activity

Biological Process: mRNA transcription; negative regulation of transcription from RNA polymerase II promoter; nuclear mRNA splicing, via spliceosome; positive regulation of DNA damage response, signal transduction by p53 class mediator; positive regulation of estrogen receptor signaling pathway; positive regulation of transcription from RNA polymerase II promoter; regulation of alternative nuclear mRNA splicing, via spliceosome; regulation of osteoblast differentiation; RNA secondary structure unwinding

Research Articles on DDX5

Similar Products

Product Notes

The DDX5 ddx5 (Catalog #AAA1271921) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgggtt attcgagtga ccgagaccgc ggccgggacc gagggtttgg tgcacctcga tttggaggaa gtagggcagg gcccttatct ggaaagaagt ttggaaaccc tggggagaaa ttagttaaaa agaagtggaa tcttgatgag ctgcctaaat ttgagaagaa tttttatcaa gagcaccctg atttggctag gcgcacagca caagaggtgg aaacatacag aagaagcaag gaaattacag ttagaggtca caactgcccg aagccagttc taaattttta tgaagccaat ttccctgcaa atgtcatgga tgttattgca agacagaatt tcactgaacc cactgctatt caagctcagg gatggccagt tgctctaagt ggattggata tggttggagt ggcacagact ggatctggga aaacattgtc ttatttgctt cctgccattg tccacatcaa tcatcagcca ttcctagaga gaggcgatgg gcctatttgt ttggtgctgg caccaactcg ggaactggcc caacaggtgc agcaagtagc tgctgaatat tgtagagcat gtcgcttgaa gtctacttgt atctacggtg gtgctcctaa gggaccacaa atacgtgatt tggagagagg tgtggaaatc tgtattgcaa cacctggaag actgattgac tttttagagt gtggaaaaac caatctgaga agaacaacct accttgtcct tgatgaagca gatagaatgc ttgatatggg ctttgaaccc caaataagga agattgtgga tcaaataaga cctgataggc aaactctaat gtggagtgcg acttggccaa aagaagtaag acagcttgct gaagatttcc tgaaagacta tattcatata aacattggtg cacttgaact gagtgcaaac cacaacattc ttcagattgt ggatgtgtgt catgacgtag aaaaggatga aaaacttatt cgtctaatgg aagagatcat gagtgagaag gagaataaaa ccattgtttt tgtggaaacc aaaagaagat gtgatgagct taccagaaaa atgaggagag atgggtggcc tgccatgggt atccatggtg acaagagtca acaagagcgt gactgggttc taaatgaatt caaacatgga aaagctccta ttctgattgc tacagatgtg gcctccagag ggctagatgt ggaagatgtg aaatttgtca tcaattatga ctaccctaac tcctcagagg attatattca tcgaattgga agaactgctc gcagtaccaa aacaggcaca gcatacactt tctttacacc taataacata aagcaagtga gcgaccttat ctctgtgctt cgtgaagcta atcaagcaat taatcccaag ttgcttcagt tggtcgaaga cagaggttca ggtcgttcca ggggtagagg aggcatgaag gatgaccgtc gggacagata ctctgcgggc aaaaggggtg gatttaatac ctttagagac agggaaaatt atgacagagg ttactctagc ctgcttaaaa gagattttgg ggcaaaaact cagaatggtg tttacagtgc tgcaaattac accaatggga gctttggaag taattttgtg tctgctggta tacagaccag ttttaggact ggtaatccaa cagggactta ccagaatggt tatgatagca ctcagcaata cggaagtaat gttccaaata tgcacaatgg tatgaaccaa caggcatatg catatcctgc tactgcagct gcacctatga ttggttatcc aatgccaaca ggatattccc aataa. It is sometimes possible for the material contained within the vial of "DDX5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.