Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX4 cdna clone

DDX4 cDNA Clone

Gene Names
DDX4; VASA
Synonyms
DDX4; DDX4 cDNA Clone; DDX4 cdna clone
Ordering
For Research Use Only!
Sequence
atgggagatgaagattgggaagcagaaatcaaccctcatatgtcttcctatgttcccatatttgagaaggataggtattctggagaaaatggagacaattttaacaggactccagcttcatcatcagaaatggatgatggaccttctcgaagagatcatttcatgaaaagtggatttgcctctgggcggaattttggaaacagagatgctggtgagtgtaataagcgagataatacatccacaatgggtggttttggagttggaaagagttttggaaacagaggtttttcaaacagcaggtttgaagatggtgatagctctggtttctggagagagtctagtaatgactgcgaagataatccaacacggaacagagggttttccaagagaggcgataatgacttagacccagacgaatgtatgcagcgcactggtggcctttttggttctagaagaccagtattaagtggcacaggtaatggtgatacttctcaaagcagaagtggcagtggaagtgaacgaggtggttacaaaggtttaaatgaagaagtaataacaggctctggaaagaattcttggaagtcagaagcagaaggaggagaaagtagtgatactcaaggaccaaaagtgacctacataccccctcctccacctgaggatgaggactccatctttgcacattatcagacaggcataaacttcgacaaatacgacactattcttgtggaagtgtctggacatgatgcaccaccagcaattctgacttttgaagaagctaatctctgtcagacactgaataacaacattgctaaagctggttatactaagcttactcctgtgcaaaaatacagtattcctatcatacttgcaggacgagatttgatggcttgcgctcaaacagggtctgggaagactgcggcttttctcctaccaattttggctcatatgatgcatgatggaataactgccagtcgttttaaagagttgcaggaaccagagtgtattattgtagcaccaactcgagaattggtcaacaagatttatttggaagccagaaaattttcttttgggacttgtgtaagagctgttgttatatatgggggaacccagctgggacattcaattcgacaaatagtacaaggctgtaatatattatgtgctactcctggaagactgatggatatcataggcaaagaaaagattggtctcaaacagatcaaatacttagttttggatgaagctgatcgcatgttggatatgggttttggtccagaaatgaagaagttaatttcttgcccaggaatgccatcaaaggaacagcgccaaacccttatgttcagtgcaacttttccagaggaaattcaaaggttggctgcagagtttttaaagtcaaattatctgtttgttgctgttggacaagtgggtggagcatgtagagatgttcagcagaccgttctccaagttggccagttctcaaaaagagagaagctcgttgaaattctgcgaaacataggggatgaaagaactatggtctttgttgaaactaagaaaaaagcagattttattgcaacttttctttgtcaagaaaaaatatcaactacaagtattcatggtgatcgggaacagagagagcgggagcaagctcttggagattttcgctttggaaagtgcccagttcttgttgctacttcagtagctgccagagggctggatattgaaaatgtgcaacatgttatcaattttgatcttccttctaccattgatgaatatgttcatcgaattgggcgtactggtcgttgtgggaatactggcagagcaatttccttttttgatcttgaatcggataaccatttagcacagcctctagtaaaagtattgacagatgctcaacaggatgttcctgcatggttggaagaaattgcctttagtacatacattcctggcttcagtggtagtacaagaggaaacgtgtttgcatcagttgataccagaaagggcaagagcactttgaacacagctgggttttcttcttcacaagctcccaatccagtagatgatgagtcatgggattaa
Sequence Length
2073
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
77,056 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 4, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 4
NCBI Official Symbol
DDX4
NCBI Official Synonym Symbols
VASA
NCBI Protein Information
probable ATP-dependent RNA helicase DDX4
UniProt Protein Name
Probable ATP-dependent RNA helicase DDX4
UniProt Gene Name
DDX4
UniProt Synonym Gene Names
VASA
UniProt Entry Name
DDX4_HUMAN

NCBI Description

DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a homolog of VASA proteins in Drosophila and several other species. The gene is specifically expressed in the germ cell lineage in both sexes and functions in germ cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]

Uniprot Description

DDX4: May play a role in germ cell development. May play a role in sperm motility. Found in a mRNP complex, at least composed of TDRD1, TDRD6, TDRD7 and DDX4. N-terminus interacts with RANBP9. Interacts with PIWIL2 and MAEL. Expressed only in ovary and testis. Expressed in migratory primordial germ cells in the region of the gonadal ridge in both sexes. Belongs to the DEAD box helicase family. DDX4/VASA subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Helicase; EC 3.6.4.13

Chromosomal Location of Human Ortholog: 5p15.2-p13.1

Cellular Component: cytoplasm; perinuclear region of cytoplasm

Molecular Function: ATP-dependent RNA helicase activity

Biological Process: DNA methylation during gametogenesis; male meiosis; RNA secondary structure unwinding; sperm motility; spermatogenesis

Research Articles on DDX4

Similar Products

Product Notes

The DDX4 ddx4 (Catalog #AAA1276690) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggagatg aagattggga agcagaaatc aaccctcata tgtcttccta tgttcccata tttgagaagg ataggtattc tggagaaaat ggagacaatt ttaacaggac tccagcttca tcatcagaaa tggatgatgg accttctcga agagatcatt tcatgaaaag tggatttgcc tctgggcgga attttggaaa cagagatgct ggtgagtgta ataagcgaga taatacatcc acaatgggtg gttttggagt tggaaagagt tttggaaaca gaggtttttc aaacagcagg tttgaagatg gtgatagctc tggtttctgg agagagtcta gtaatgactg cgaagataat ccaacacgga acagagggtt ttccaagaga ggcgataatg acttagaccc agacgaatgt atgcagcgca ctggtggcct ttttggttct agaagaccag tattaagtgg cacaggtaat ggtgatactt ctcaaagcag aagtggcagt ggaagtgaac gaggtggtta caaaggttta aatgaagaag taataacagg ctctggaaag aattcttgga agtcagaagc agaaggagga gaaagtagtg atactcaagg accaaaagtg acctacatac cccctcctcc acctgaggat gaggactcca tctttgcaca ttatcagaca ggcataaact tcgacaaata cgacactatt cttgtggaag tgtctggaca tgatgcacca ccagcaattc tgacttttga agaagctaat ctctgtcaga cactgaataa caacattgct aaagctggtt atactaagct tactcctgtg caaaaataca gtattcctat catacttgca ggacgagatt tgatggcttg cgctcaaaca gggtctggga agactgcggc ttttctccta ccaattttgg ctcatatgat gcatgatgga ataactgcca gtcgttttaa agagttgcag gaaccagagt gtattattgt agcaccaact cgagaattgg tcaacaagat ttatttggaa gccagaaaat tttcttttgg gacttgtgta agagctgttg ttatatatgg gggaacccag ctgggacatt caattcgaca aatagtacaa ggctgtaata tattatgtgc tactcctgga agactgatgg atatcatagg caaagaaaag attggtctca aacagatcaa atacttagtt ttggatgaag ctgatcgcat gttggatatg ggttttggtc cagaaatgaa gaagttaatt tcttgcccag gaatgccatc aaaggaacag cgccaaaccc ttatgttcag tgcaactttt ccagaggaaa ttcaaaggtt ggctgcagag tttttaaagt caaattatct gtttgttgct gttggacaag tgggtggagc atgtagagat gttcagcaga ccgttctcca agttggccag ttctcaaaaa gagagaagct cgttgaaatt ctgcgaaaca taggggatga aagaactatg gtctttgttg aaactaagaa aaaagcagat tttattgcaa cttttctttg tcaagaaaaa atatcaacta caagtattca tggtgatcgg gaacagagag agcgggagca agctcttgga gattttcgct ttggaaagtg cccagttctt gttgctactt cagtagctgc cagagggctg gatattgaaa atgtgcaaca tgttatcaat tttgatcttc cttctaccat tgatgaatat gttcatcgaa ttgggcgtac tggtcgttgt gggaatactg gcagagcaat ttcctttttt gatcttgaat cggataacca tttagcacag cctctagtaa aagtattgac agatgctcaa caggatgttc ctgcatggtt ggaagaaatt gcctttagta catacattcc tggcttcagt ggtagtacaa gaggaaacgt gtttgcatca gttgatacca gaaagggcaa gagcactttg aacacagctg ggttttcttc ttcacaagct cccaatccag tagatgatga gtcatgggat taa. It is sometimes possible for the material contained within the vial of "DDX4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.