Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX3Y cdna clone

DDX3Y cDNA Clone

Gene Names
DDX3Y; DBY
Synonyms
DDX3Y; DDX3Y cDNA Clone; DDX3Y cdna clone
Ordering
For Research Use Only!
Sequence
atgagtcatgtggtggtgaaaaatgaccctgaactggaccagcagcttgctaatctggacctgaactctgaaaaacagagtggaggagcaagtacagcgagcaaagggcgctatatacctcctcacttaaggaacagagaagcatctaaaggattccatgataaagacagttcaggttggagttgcagcaaagataaggatgcatatagcagttttgggtctcgagattctagaggaaagcctggttatttcagtgaacgtggaagtggatcaaggggaagatttgatgatcgtggacggagtgactatgatggtattggcaatcgtgaaagacctggctttggcagatttgaacggagtggacatagtcgttggtgtgacaagtcagttgaagatgattggtcaaaaccacttccaccaagtgaacgcttggagcaagaactgttttctggaggaaacacggggattaactttgagaaatatgatgatataccagtagaggcaaccggcagtaactgtcctccacatattgagaattttagcgatattgacatgggagaaattatcatggggaacattgaacttactcgctatactcgtcctactccagtgcaaaaacatgccattcctattattaagggaaaaagagacttaatggcttgtgcccaaacaggatctgggaaaactgcagcatttcttttacccatactgagtcagatatatacagatggtccaggagaagctttgaaggctgtgaaggaaaatggaaggtatgggcgccgcaaacaatatccaatatccttggttttagccccaacaagagaattggctgtacagatctatgaggaagccagaaaattttcctaccgatctagagttcgtccttgtgtagtttatggtggtgctgatattggtcagcagattcgggacttagaacgtggatgccacttgttagtagccactccaggacgtctagtggatatgatggaaagaggaaagattggattagacttctgcaagtacttagtgttggatgaagctgataggatgctggatatgggatttgaacctcagatacgtcgtatagttgaacaagatactatgccaccaaagggcgttcgtcacaccatgatgtttagtgctacttttcctaaggaaatacagatgcttgctcgtgactttttggatgaatatatctttttggctgtaggcagagtaggctctacctctgagaacatcacacagaaagtagtttgggtggaagacttagataaacggtcatttctactggacattttaggtgcaacagggagtgattcacttactttagtgtttgtggagaccaaaaagggagcagattccctggaggatttcttataccatgaaggatatgcttgtactagtattcatggagaccggtcacagagagatcgagaggaggcccttcaccagtttcgctcaggaaaaagcccaattctagtggctacagctgtggcagcacgaggactagacatttcaaatgtgagacatgttatcaattttgatttgccaagtgatattgaagaatatgtgcatcgtattggccgtacaggacgtgtaggaaacctgggccttgccacctcattctttaatgaaaaaaatatgaatattacaaaggatttgttggatcttcttgtagaagctaaacaagaagtgccttcttggttggaaaatatggcttatgaacaccactacaagggtggcagtcgtggacgatctaaaagtaatagattcagtggaggatttggtgccagagactatcgacaaagtagtggttccagcagttctggctttggtgctagtcgcggaagcagcagccgcagtggtggaggtggttacggcaacagcagaggatttggtggaggtggctatggaggcttctacaatagtgatggatatggaggaaattataactcccagggggttgactggtggggcaactga
Sequence Length
1983
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,416 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 3, Y-linked
NCBI Official Symbol
DDX3Y
NCBI Official Synonym Symbols
DBY
NCBI Protein Information
ATP-dependent RNA helicase DDX3Y
UniProt Protein Name
ATP-dependent RNA helicase DDX3Y
UniProt Gene Name
DDX3Y
UniProt Synonym Gene Names
DBY
UniProt Entry Name
DDX3Y_HUMAN

NCBI Description

The protein encoded by this gene is a member of the DEAD-box RNA helicase family, characterized by nine conserved motifs, included the conserved Asp-Glu-Ala-Asp (DEAD) motif. These motifs are thought to be involved in ATP binding, hydrolysis, RNA binding, and in the formation of intramolecular interactions. This protein shares high similarity to DDX3X, on the X chromosome, but a deletion of this gene is not complemented by DDX3X. Mutations in this gene result in male infertility, a reduction in germ cell numbers, and can result in Sertoli-cell only sydrome. Pseudogenes sharing similarity to both this gene and the DDX3X paralog are found on chromosome 4 and the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]

Uniprot Description

DDX3Y: a Y-linked DEAD box protein. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp, are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. DBY mutations causes male infertility, Sertoli cell-only syndrome or severe hypospermatogenesis, suggesting that this gene plays a key role in the spermatogenic process. Two alternatively spliced transcripts differ only in the length of the 3' UTR.

Protein type: Helicase; EC 3.6.4.13; RNA-binding

Chromosomal Location of Human Ortholog: Yq11

Cellular Component: cytoplasm; membrane

Molecular Function: ATP-dependent RNA helicase activity

Biological Process: chromosome segregation; regulation of gene expression; RNA secondary structure unwinding; translational initiation

Disease: Spermatogenic Failure, Y-linked, 2

Research Articles on DDX3Y

Similar Products

Product Notes

The DDX3Y ddx3y (Catalog #AAA1275800) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtcatg tggtggtgaa aaatgaccct gaactggacc agcagcttgc taatctggac ctgaactctg aaaaacagag tggaggagca agtacagcga gcaaagggcg ctatatacct cctcacttaa ggaacagaga agcatctaaa ggattccatg ataaagacag ttcaggttgg agttgcagca aagataagga tgcatatagc agttttgggt ctcgagattc tagaggaaag cctggttatt tcagtgaacg tggaagtgga tcaaggggaa gatttgatga tcgtggacgg agtgactatg atggtattgg caatcgtgaa agacctggct ttggcagatt tgaacggagt ggacatagtc gttggtgtga caagtcagtt gaagatgatt ggtcaaaacc acttccacca agtgaacgct tggagcaaga actgttttct ggaggaaaca cggggattaa ctttgagaaa tatgatgata taccagtaga ggcaaccggc agtaactgtc ctccacatat tgagaatttt agcgatattg acatgggaga aattatcatg gggaacattg aacttactcg ctatactcgt cctactccag tgcaaaaaca tgccattcct attattaagg gaaaaagaga cttaatggct tgtgcccaaa caggatctgg gaaaactgca gcatttcttt tacccatact gagtcagata tatacagatg gtccaggaga agctttgaag gctgtgaagg aaaatggaag gtatgggcgc cgcaaacaat atccaatatc cttggtttta gccccaacaa gagaattggc tgtacagatc tatgaggaag ccagaaaatt ttcctaccga tctagagttc gtccttgtgt agtttatggt ggtgctgata ttggtcagca gattcgggac ttagaacgtg gatgccactt gttagtagcc actccaggac gtctagtgga tatgatggaa agaggaaaga ttggattaga cttctgcaag tacttagtgt tggatgaagc tgataggatg ctggatatgg gatttgaacc tcagatacgt cgtatagttg aacaagatac tatgccacca aagggcgttc gtcacaccat gatgtttagt gctacttttc ctaaggaaat acagatgctt gctcgtgact ttttggatga atatatcttt ttggctgtag gcagagtagg ctctacctct gagaacatca cacagaaagt agtttgggtg gaagacttag ataaacggtc atttctactg gacattttag gtgcaacagg gagtgattca cttactttag tgtttgtgga gaccaaaaag ggagcagatt ccctggagga tttcttatac catgaaggat atgcttgtac tagtattcat ggagaccggt cacagagaga tcgagaggag gcccttcacc agtttcgctc aggaaaaagc ccaattctag tggctacagc tgtggcagca cgaggactag acatttcaaa tgtgagacat gttatcaatt ttgatttgcc aagtgatatt gaagaatatg tgcatcgtat tggccgtaca ggacgtgtag gaaacctggg ccttgccacc tcattcttta atgaaaaaaa tatgaatatt acaaaggatt tgttggatct tcttgtagaa gctaaacaag aagtgccttc ttggttggaa aatatggctt atgaacacca ctacaagggt ggcagtcgtg gacgatctaa aagtaataga ttcagtggag gatttggtgc cagagactat cgacaaagta gtggttccag cagttctggc tttggtgcta gtcgcggaag cagcagccgc agtggtggag gtggttacgg caacagcaga ggatttggtg gaggtggcta tggaggcttc tacaatagtg atggatatgg aggaaattat aactcccagg gggttgactg gtggggcaac tga. It is sometimes possible for the material contained within the vial of "DDX3Y, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.