DDX31 cdna clone
DDX31 cDNA Clone
Gene Names
DDX31; PPP1R25
Synonyms
DDX31; DDX31 cDNA Clone; DDX31 cdna clone
Sequence
atgttttctccaaagaagcattcggttagcacaagtgatagaaaccaggaggagagacagtgcattaagacttcatcactgtttaaaaacaaccctgacattccagaactccacagacctgtggtaaagcaggtgcaagaaaaagtgtttacttcagctgcttttcatgagctgggcctccacccacatttaatttccacaataaatacggtcttaaaaatgtctagtatgaccagtgttcagaagcaaagtattcctgtgttgctggaaggcagagatgctctcgtgagatcccagacgggctcaggtaaaactcttgcctattgcatccctgtggtccagtcccttcaagcaatggagtcaaaaatacagcgcagtgatggcccctatgccctggtgctcgtgccaacgagagagctagctctacaaagctttgacactgtccagaaactgcttaagcctttcacctggattgtgcctggagtgttaatgggaggagagaagagaaaatcagaaaaggccagactccgcaaaggaataaatatccttatctcaactcctggacgcctggtggatcatataaaatccacaaagaacattcattttagtcggctgcggtggttggtgtttgatgaagcagacagaatcttggatttgggttttgaaaaggacatcacagtgatacttaatgctgtaaatgctgaatgccaaaaacgacagaatgtcttgctatcagcgacactcacagaaggtgtaacgcggctagctgatatcagtttgcatgatccagtcagtatttctgtcctggacaagagccatgaccagttgaacccaaaggacaaagcggtccaggaggtctgtcctccaccagctggcgacaagctggacagctttgcaataccagagagtctcaagcagcatgtgactgtggttcccagcaaactgaggcttgtctgcctagcggccttcatccttcagaaatgcaagtttgaggaagaccagaagatggttgtctttttctcaagttgcgagctggtggagttccactacagcctcttcctacagaccctgctgagcagctcaggggcgccggcatcagggcagttgccatctgcctccatgcgattaaaattcctacggctgcatggcggcatggagcaggaggaaagaacagcagtgtttcaggaattttcacattccagaagaggcgtccttctttgcacggatgttgcagctcggggcttagatctccctcaagtcacgtggattgttcagtacaacgctccatcttcacctgcagaatacatccaccggattggaagaaccgcccggattggctgccatgggagcagcctgctcattttggctccttcggaggcagaatatgtcaactcgttggcttctcacaaaatcaacgtttctgagattaagatggaagatattttgtgtgttctgacaagagatgattgttttaaagggaaacgatggggagcccagaaatcccatgctgttggcccccaggaaatccgagagcgagccacagtcttgcagacggtatttgaagattacgtgcactccagtgagaggagggtctcctgggcaaagaaagctctgcagtccttcatccaagcctacgccacctaccccagggagctgaagcacatcttccacgtccgatccctccaccttgggcatgtggcgaagagcttcggactaagagatgcccccaggaatcttagtgccttgactagaaagaagaggaaagcacacgtgaaaaggcctgaccttcataagaagacccagagtaaacacagcctcgctgaaatcctacgttcggaatactcaagcggcatggaggccgacgtcgccaaggtcaaaaagcaaaacgcacctggagagcctggtggccggcccctgcagcacagtctgcagccgacaccctgctttggccgtgggaaaacattaaaatggagaaaaacccaaaaaggtgtacagcgggacagcaagacttcccagaaagtttaa
Sequence Length
2025
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
64,137 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 31, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 31
NCBI Official Symbol
DDX31
NCBI Official Synonym Symbols
PPP1R25
NCBI Protein Information
probable ATP-dependent RNA helicase DDX31
UniProt Protein Name
Probable ATP-dependent RNA helicase DDX31
Protein Family
UniProt Gene Name
DDX31
UniProt Entry Name
DDX31_HUMAN
NCBI Description
DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Uniprot Description
DDX31: Probable ATP-dependent RNA helicase. Belongs to the DEAD box helicase family. DDX31/DBP7 subfamily. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Hydrolase; Nucleolus; EC 3.6.4.13
Chromosomal Location of Human Ortholog: 9q34.13
Cellular Component: Golgi apparatus; intracellular membrane-bound organelle; nucleolus
Molecular Function: ATP-dependent RNA helicase activity; protein binding
Biological Process: ribosome biogenesis and assembly; RNA secondary structure unwinding
Research Articles on DDX31
Similar Products
Product Notes
The DDX31 ddx31 (Catalog #AAA1276087) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttttctc caaagaagca ttcggttagc acaagtgata gaaaccagga ggagagacag tgcattaaga cttcatcact gtttaaaaac aaccctgaca ttccagaact ccacagacct gtggtaaagc aggtgcaaga aaaagtgttt acttcagctg cttttcatga gctgggcctc cacccacatt taatttccac aataaatacg gtcttaaaaa tgtctagtat gaccagtgtt cagaagcaaa gtattcctgt gttgctggaa ggcagagatg ctctcgtgag atcccagacg ggctcaggta aaactcttgc ctattgcatc cctgtggtcc agtcccttca agcaatggag tcaaaaatac agcgcagtga tggcccctat gccctggtgc tcgtgccaac gagagagcta gctctacaaa gctttgacac tgtccagaaa ctgcttaagc ctttcacctg gattgtgcct ggagtgttaa tgggaggaga gaagagaaaa tcagaaaagg ccagactccg caaaggaata aatatcctta tctcaactcc tggacgcctg gtggatcata taaaatccac aaagaacatt cattttagtc ggctgcggtg gttggtgttt gatgaagcag acagaatctt ggatttgggt tttgaaaagg acatcacagt gatacttaat gctgtaaatg ctgaatgcca aaaacgacag aatgtcttgc tatcagcgac actcacagaa ggtgtaacgc ggctagctga tatcagtttg catgatccag tcagtatttc tgtcctggac aagagccatg accagttgaa cccaaaggac aaagcggtcc aggaggtctg tcctccacca gctggcgaca agctggacag ctttgcaata ccagagagtc tcaagcagca tgtgactgtg gttcccagca aactgaggct tgtctgccta gcggccttca tccttcagaa atgcaagttt gaggaagacc agaagatggt tgtctttttc tcaagttgcg agctggtgga gttccactac agcctcttcc tacagaccct gctgagcagc tcaggggcgc cggcatcagg gcagttgcca tctgcctcca tgcgattaaa attcctacgg ctgcatggcg gcatggagca ggaggaaaga acagcagtgt ttcaggaatt ttcacattcc agaagaggcg tccttctttg cacggatgtt gcagctcggg gcttagatct ccctcaagtc acgtggattg ttcagtacaa cgctccatct tcacctgcag aatacatcca ccggattgga agaaccgccc ggattggctg ccatgggagc agcctgctca ttttggctcc ttcggaggca gaatatgtca actcgttggc ttctcacaaa atcaacgttt ctgagattaa gatggaagat attttgtgtg ttctgacaag agatgattgt tttaaaggga aacgatgggg agcccagaaa tcccatgctg ttggccccca ggaaatccga gagcgagcca cagtcttgca gacggtattt gaagattacg tgcactccag tgagaggagg gtctcctggg caaagaaagc tctgcagtcc ttcatccaag cctacgccac ctaccccagg gagctgaagc acatcttcca cgtccgatcc ctccaccttg ggcatgtggc gaagagcttc ggactaagag atgcccccag gaatcttagt gccttgacta gaaagaagag gaaagcacac gtgaaaaggc ctgaccttca taagaagacc cagagtaaac acagcctcgc tgaaatccta cgttcggaat actcaagcgg catggaggcc gacgtcgcca aggtcaaaaa gcaaaacgca cctggagagc ctggtggccg gcccctgcag cacagtctgc agccgacacc ctgctttggc cgtgggaaaa cattaaaatg gagaaaaacc caaaaaggtg tacagcggga cagcaagact tcccagaaag tttaa. It is sometimes possible for the material contained within the vial of "DDX31, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
