Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX27 cdna clone

DDX27 cDNA Clone

Gene Names
DDX27; DRS1; RHLP; Drs1p; PP3241; HSPC259; dJ686N3.1
Synonyms
DDX27; DDX27 cDNA Clone; DDX27 cdna clone
Ordering
For Research Use Only!
Sequence
atgcttgcggacctcggcttaatcggaaccataggcgaggatgacgaggtgccggtggagcccgagtctgactccggggacgaggaagaggaggggcccattgtgctgggcagacgacaaaaagctttggggaagaaccgcagtgctgatttcaaccctgatttcgttttcactgagaaggaggggacgtacgatggcagctgggccctggctgatgtcatgagccaactcaagaagaagagggcagccactacattagatgagaagattgagaaagttcgaaagaaaaggaaaacagaggataaagaagccaagtctgggaagttggaaaaggagaaagaagcaaaggaaggctctgaaccaaaggagcaggaagaccttcaagagaatgatgaggaaggctcagaagatgaagcctcggagactgactactcatcagctgatgagaacatcctcaccaaagcagatacactcaaagtaaaggatcggaagaagaagaagaagaaaggacaggaagcaggaggattttttgaagatgcatctcagtacgatgaaaacctctcgttccaggacatgaacctttcccgccctcttctgaaggccattacagccatgggcttcaagcagcccaccccgatccagaaggcgtgcatacctgtgggtctattggggaaggacatctgtgcctgtgcagccactgggacaggtaaaactgccgcctttgccctgcctgttttggagcgtctgatttataaaccccgccaggctccagtcacccgcgtgctggtgctagtgcccacccgagagctgggcatccaggtgcactctgtcaccagacagctggcccagttctgcaacatcaccacctgcctggctgtgggcggcttggatgtgaagtctcaggaagcagctcttcgggcagcgcctgacatcctcatcgccaccccaggccggctcatcgatcacctccacaactgcccttccttccacctgagcagcatcgaggtgctcatcctggacgaggctgacaggatgctggatgagtactttgaggagcagatgaaggagatcatccgaatgtgttcccaccaccgccagaccatgctcttctcggccaccatgacagacgaggtgaaagatctggcttctgtctccttgaagaatcctgtccggatatttgtgaacagcaacacagatgtggctccctttctgcggcaggagttcatccggatccggcctaatcgtgaaggagaccgggaagccatcgtggcagctttgttgacgaggaccttcactgaccatgtgatgctgttcacgcaaaccaagaagcaggcccaccgcatgcacatcctcctggggctcatggggctgcaggtgggtgagctccatggcaacttgtcacagacgcagcggctggaggccctccggcgttttaaggatgaacagattgacatcctcgtggccactgatgtggcagcccgtggacttgacattgagggggtcaaaacggtaatcaacttcacaatgcctaataccatcaaacattatgtccaccgggtggggcgaacagcacgtgctggcagggctgggcgctcagtctctctggtgggagaagatgagcggaagatgctgaaggagattgtaaaagctgccaaggcccctgtgaaggccaggatacttccccaagatgtcatcctcaaattccgggacaagattgagaaaatggagaaagatgtgtatgcagttctgcagctagaggcggaggaaaaagagatgcagcagtcagaagcccagatcaatacagcaaagcggctcctggagaaggggaaggaggcagtggtccaagagcccgagaggagctggttccagaccaaagaagagaggaagaaggagaaaattgccaaagctctgcaggaatttgacttggccttaagaggaaagaagaaaaggaagaagtttatgaaggatgccaaaaaaaagggggagatgacagcagaggaaaggtctcagtttgaaatcctcaaggcgcagatgtttgctgaacggctagcgaagaggaatcgcagagccaagcgggcccgagcaatgcccgaggaggagccagtgagaggtcctgccaagaagcaaaagcaggggaagaaatctgtatttgatgaagaactcaccaacacaagcaagaaggccctgaaacagtatcgagctagcccttcctttgaagaaaggaaacagttgggcttgccccaccagagacgaggaggaaactttaaatctaaatccagatacaagaggaggaagtag
Sequence Length
2298
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
89,835 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 27, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 27
NCBI Official Symbol
DDX27
NCBI Official Synonym Symbols
DRS1; RHLP; Drs1p; PP3241; HSPC259; dJ686N3.1
NCBI Protein Information
probable ATP-dependent RNA helicase DDX27
UniProt Protein Name
Probable ATP-dependent RNA helicase DDX27
UniProt Gene Name
DDX27
UniProt Entry Name
DDX27_HUMAN

NCBI Description

DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, the function of which has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

DDX27: Probable ATP-dependent RNA helicase. Belongs to the DEAD box helicase family. DDX27/DRS1 subfamily.

Protein type: RNA-binding; Helicase; EC 3.6.4.13

Chromosomal Location of Human Ortholog: 20q13.13

Cellular Component: chromosome; nucleolus

Molecular Function: ATP-dependent RNA helicase activity; protein binding

Biological Process: RNA secondary structure unwinding; rRNA processing

Research Articles on DDX27

Similar Products

Product Notes

The DDX27 ddx27 (Catalog #AAA1268684) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcttgcgg acctcggctt aatcggaacc ataggcgagg atgacgaggt gccggtggag cccgagtctg actccgggga cgaggaagag gaggggccca ttgtgctggg cagacgacaa aaagctttgg ggaagaaccg cagtgctgat ttcaaccctg atttcgtttt cactgagaag gaggggacgt acgatggcag ctgggccctg gctgatgtca tgagccaact caagaagaag agggcagcca ctacattaga tgagaagatt gagaaagttc gaaagaaaag gaaaacagag gataaagaag ccaagtctgg gaagttggaa aaggagaaag aagcaaagga aggctctgaa ccaaaggagc aggaagacct tcaagagaat gatgaggaag gctcagaaga tgaagcctcg gagactgact actcatcagc tgatgagaac atcctcacca aagcagatac actcaaagta aaggatcgga agaagaagaa gaagaaagga caggaagcag gaggattttt tgaagatgca tctcagtacg atgaaaacct ctcgttccag gacatgaacc tttcccgccc tcttctgaag gccattacag ccatgggctt caagcagccc accccgatcc agaaggcgtg catacctgtg ggtctattgg ggaaggacat ctgtgcctgt gcagccactg ggacaggtaa aactgccgcc tttgccctgc ctgttttgga gcgtctgatt tataaacccc gccaggctcc agtcacccgc gtgctggtgc tagtgcccac ccgagagctg ggcatccagg tgcactctgt caccagacag ctggcccagt tctgcaacat caccacctgc ctggctgtgg gcggcttgga tgtgaagtct caggaagcag ctcttcgggc agcgcctgac atcctcatcg ccaccccagg ccggctcatc gatcacctcc acaactgccc ttccttccac ctgagcagca tcgaggtgct catcctggac gaggctgaca ggatgctgga tgagtacttt gaggagcaga tgaaggagat catccgaatg tgttcccacc accgccagac catgctcttc tcggccacca tgacagacga ggtgaaagat ctggcttctg tctccttgaa gaatcctgtc cggatatttg tgaacagcaa cacagatgtg gctccctttc tgcggcagga gttcatccgg atccggccta atcgtgaagg agaccgggaa gccatcgtgg cagctttgtt gacgaggacc ttcactgacc atgtgatgct gttcacgcaa accaagaagc aggcccaccg catgcacatc ctcctggggc tcatggggct gcaggtgggt gagctccatg gcaacttgtc acagacgcag cggctggagg ccctccggcg ttttaaggat gaacagattg acatcctcgt ggccactgat gtggcagccc gtggacttga cattgagggg gtcaaaacgg taatcaactt cacaatgcct aataccatca aacattatgt ccaccgggtg gggcgaacag cacgtgctgg cagggctggg cgctcagtct ctctggtggg agaagatgag cggaagatgc tgaaggagat tgtaaaagct gccaaggccc ctgtgaaggc caggatactt ccccaagatg tcatcctcaa attccgggac aagattgaga aaatggagaa agatgtgtat gcagttctgc agctagaggc ggaggaaaaa gagatgcagc agtcagaagc ccagatcaat acagcaaagc ggctcctgga gaaggggaag gaggcagtgg tccaagagcc cgagaggagc tggttccaga ccaaagaaga gaggaagaag gagaaaattg ccaaagctct gcaggaattt gacttggcct taagaggaaa gaagaaaagg aagaagttta tgaaggatgc caaaaaaaag ggggagatga cagcagagga aaggtctcag tttgaaatcc tcaaggcgca gatgtttgct gaacggctag cgaagaggaa tcgcagagcc aagcgggccc gagcaatgcc cgaggaggag ccagtgagag gtcctgccaa gaagcaaaag caggggaaga aatctgtatt tgatgaagaa ctcaccaaca caagcaagaa ggccctgaaa cagtatcgag ctagcccttc ctttgaagaa aggaaacagt tgggcttgcc ccaccagaga cgaggaggaa actttaaatc taaatccaga tacaagagga ggaagtag. It is sometimes possible for the material contained within the vial of "DDX27, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.