Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX20 cdna clone

DDX20 cDNA Clone

Gene Names
DDX20; DP103; GEMIN3
Synonyms
DDX20; DDX20 cDNA Clone; DDX20 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggcatttgaagcctcgggagccttagcggcagtggcgactgctatgccggctgagcatgtggccgtgcaggtcccggccccagagccaacacccgggcctgtgaggatcctgcggaccgctcaggatctcagcagcccgcggacccgcacgggggatgtgctgttggcggagccggccgacttcgagtcactgctgctttcgcggccggtgctggaggggctgcgggcggccggcttcgagaggccctcgccggtgcagctcaaggccatcccgctggggcgctgcgggctcgatttaattgttcaagctaaatctggcaccgggaaaacctgtgtgttctccaccatagctttggactctcttgttcttgaaaacttaagtacccagattttgatcttggctcctacaagagaaattgctgtacagatacattctgttattacagccattggaataaaaatggaaggcttagagtgtcatgtctttattggagggaccccattatcacaagacaaaaccagacttaaaaagtgtcatattgctgttggatctcctggcagaattaagcaactcatagaacttgactacttgaacccaggcagtatacgcctctttattcttgatgaagcagataagcttttagaagaaggcagcttccaggagcaaataaattggatttattcttccttgcctgccagtaaacagatgctggcagtatcagctacttatcccgaatttttggctaatgctttgacaaagtacatgagagatcccacttttgtaagactgaattccagtgatccaagtctcataggtttgaagcagtattacaaagttgtcaattcataccctttggcacataaggtttttgaggaaaagactcagcatttacaggaactgttcagcagaattccatttaatcaagctttagtcttttctaatttgcacagcagagcacaacatttggctgatatcctttcttctaaaggctttcctgctgagtgcatttcaggcaatatgaatcagaatcagcgtcttgatgctatggctaaactgaagcactttcattgcagagtcctcatttccacagatttgacttctcgtgggattgatgctgagaaggtgaatctggttgtaaatctggatgtaccattggattgggagacatacatgcatcggattgggagagctggccgttttggtacattggggctgacagtgacctactgttgccggggagaggaagaaaatatgatgatgagaattgcccagaaatgtaatatcaaccttctccctttaccagatcccattccttctggtctgatggaagaatgtgtggattgggatgtggaagttaaagctgctgtgcatacatatggtatagcaagtgtacctaaccaacccttaaaaaagcaaattcagaaaatagagagaacccttcaaattcagaaagctcatggtgaccacatggcttcctctagaaataattctgtatctggactatcagtcaaatcaaaaaataataccaaacaaaagcttcctgtgaaaagccactcagaatgtggaatcatagaaaaagcaacatcaccaaaagaactgggctgtgacaggcaatccgaagagcaaatgaagaattctgttcagactcccgttgaaaactccaccaacagtcagcaccaggtcaaagaagctttacctgtgtcactcccccagattccttgtctgtcttcctttaaaatccatcagccatacacgttgacttttgctgaattggtagaggattatgaacattatattaaagaggggttagagaaacctgtggaaatcatcaggcactacacaggccctggggatcagactgtgaatcctcaaaatggttttgtgagaaataaagttactgaacagagagtccctgtattggcaagtagtagccaatctggagactctgagagtgacagtgattcttacagctcaagaacctcttcccagagcaaaggaaataagtcatacttggaaggctcttctgataatcagctgaaagactctgaatctacgcctgtggatgatcgtatttctttggaacaaccaccaaatggaagtgacacccccaatccagagaaatatcaagaatcacctggaatccagatgaagacaagacttaaagagggggctagccagagagctaagcagagccggagaaacctacccaggcggtcttccttcagattgcagactgaagcccaggaagatgattggtatgactgtcatagggaaatacgtctgagtttttctgatacctatcaggattatgaggagtactggagagcttactacagggcatggcaagaatattatgctgccgcttctcattcatattattggaatgctcagagacatccaagttggatggcagcttatcacatgaataccatttatctacaagaaatgatgcatagtaaccagtga
Sequence Length
2475
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,272 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 20, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 20
NCBI Official Symbol
DDX20
NCBI Official Synonym Symbols
DP103; GEMIN3
NCBI Protein Information
probable ATP-dependent RNA helicase DDX20
UniProt Protein Name
Probable ATP-dependent RNA helicase DDX20
UniProt Gene Name
DDX20
UniProt Synonym Gene Names
DP103; GEMIN3
UniProt Entry Name
DDX20_HUMAN

NCBI Description

DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which has an ATPase activity and is a component of the survival of motor neurons (SMN) complex. This protein interacts directly with SMN, the spinal muscular atrophy gene product, and may play a catalytic role in the function of the SMN complex on RNPs. [provided by RefSeq, Jul 2008]

Uniprot Description

GEMIN3: an ubiquitous DEAD box protein, which has an ATPase activity and is a component of the survival of motor neurons (SMN) complex. Interacts directly with SMN, the spinal muscular atrophy gene product, and may play a catalytic role in the function of the SMN complex on RNPs. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp, are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly.

Protein type: EC 3.6.4.13; Nuclear receptor co-regulator; RNA splicing; Helicase

Chromosomal Location of Human Ortholog: 1p21.1-p13.2

Cellular Component: cytoplasm; cytoskeleton; cytosol; membrane; nucleoplasm; nucleus; SMN complex

Molecular Function: ATP-dependent RNA helicase activity; protein binding

Biological Process: assembly of spliceosomal tri-snRNP; negative regulation of transcription from RNA polymerase II promoter; nuclear import; positive regulation of apoptosis; RNA processing; RNA secondary structure unwinding; spliceosomal snRNP biogenesis

Research Articles on DDX20

Similar Products

Product Notes

The DDX20 ddx20 (Catalog #AAA1266975) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg catttgaagc ctcgggagcc ttagcggcag tggcgactgc tatgccggct gagcatgtgg ccgtgcaggt cccggcccca gagccaacac ccgggcctgt gaggatcctg cggaccgctc aggatctcag cagcccgcgg acccgcacgg gggatgtgct gttggcggag ccggccgact tcgagtcact gctgctttcg cggccggtgc tggaggggct gcgggcggcc ggcttcgaga ggccctcgcc ggtgcagctc aaggccatcc cgctggggcg ctgcgggctc gatttaattg ttcaagctaa atctggcacc gggaaaacct gtgtgttctc caccatagct ttggactctc ttgttcttga aaacttaagt acccagattt tgatcttggc tcctacaaga gaaattgctg tacagataca ttctgttatt acagccattg gaataaaaat ggaaggctta gagtgtcatg tctttattgg agggacccca ttatcacaag acaaaaccag acttaaaaag tgtcatattg ctgttggatc tcctggcaga attaagcaac tcatagaact tgactacttg aacccaggca gtatacgcct ctttattctt gatgaagcag ataagctttt agaagaaggc agcttccagg agcaaataaa ttggatttat tcttccttgc ctgccagtaa acagatgctg gcagtatcag ctacttatcc cgaatttttg gctaatgctt tgacaaagta catgagagat cccacttttg taagactgaa ttccagtgat ccaagtctca taggtttgaa gcagtattac aaagttgtca attcataccc tttggcacat aaggtttttg aggaaaagac tcagcattta caggaactgt tcagcagaat tccatttaat caagctttag tcttttctaa tttgcacagc agagcacaac atttggctga tatcctttct tctaaaggct ttcctgctga gtgcatttca ggcaatatga atcagaatca gcgtcttgat gctatggcta aactgaagca ctttcattgc agagtcctca tttccacaga tttgacttct cgtgggattg atgctgagaa ggtgaatctg gttgtaaatc tggatgtacc attggattgg gagacataca tgcatcggat tgggagagct ggccgttttg gtacattggg gctgacagtg acctactgtt gccggggaga ggaagaaaat atgatgatga gaattgccca gaaatgtaat atcaaccttc tccctttacc agatcccatt ccttctggtc tgatggaaga atgtgtggat tgggatgtgg aagttaaagc tgctgtgcat acatatggta tagcaagtgt acctaaccaa cccttaaaaa agcaaattca gaaaatagag agaacccttc aaattcagaa agctcatggt gaccacatgg cttcctctag aaataattct gtatctggac tatcagtcaa atcaaaaaat aataccaaac aaaagcttcc tgtgaaaagc cactcagaat gtggaatcat agaaaaagca acatcaccaa aagaactggg ctgtgacagg caatccgaag agcaaatgaa gaattctgtt cagactcccg ttgaaaactc caccaacagt cagcaccagg tcaaagaagc tttacctgtg tcactccccc agattccttg tctgtcttcc tttaaaatcc atcagccata cacgttgact tttgctgaat tggtagagga ttatgaacat tatattaaag aggggttaga gaaacctgtg gaaatcatca ggcactacac aggccctggg gatcagactg tgaatcctca aaatggtttt gtgagaaata aagttactga acagagagtc cctgtattgg caagtagtag ccaatctgga gactctgaga gtgacagtga ttcttacagc tcaagaacct cttcccagag caaaggaaat aagtcatact tggaaggctc ttctgataat cagctgaaag actctgaatc tacgcctgtg gatgatcgta tttctttgga acaaccacca aatggaagtg acacccccaa tccagagaaa tatcaagaat cacctggaat ccagatgaag acaagactta aagagggggc tagccagaga gctaagcaga gccggagaaa cctacccagg cggtcttcct tcagattgca gactgaagcc caggaagatg attggtatga ctgtcatagg gaaatacgtc tgagtttttc tgatacctat caggattatg aggagtactg gagagcttac tacagggcat ggcaagaata ttatgctgcc gcttctcatt catattattg gaatgctcag agacatccaa gttggatggc agcttatcac atgaatacca tttatctaca agaaatgatg catagtaacc agtga. It is sometimes possible for the material contained within the vial of "DDX20, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.