Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX19B cdna clone

DDX19B cDNA Clone

Gene Names
DDX19B; DBP5; RNAh; DDX19
Synonyms
DDX19B; DDX19B cDNA Clone; DDX19B cdna clone
Ordering
For Research Use Only!
Sequence
atggccactgactcatgggccctggcggtggacgagcaggaagctgcggctgagtcgttgagcaacttgcatcttaaggaagagaaaatcaaaccagataccaatggtgctgttgtcaagaccaatgccaatgcagagaagacagatgaagaagagaaagaggacagagctgcccagtccttactcaacaagctgatcagaagcaaccttgttgataacacaaaccaagtggaagtcctgcagcgggatccaaactcccctctgtactcggtgaagtcttttgaagagcttcggctgaaaccacagcttctccaaggagtctatgccatgggtttcaatcgtccatccaagatacaagagaacgcattgccactgatgcttgctgagcccccacagaacttaattgcccaatctcagtctggtactggtaaaacagctgccttcgtgctggccatgcttagccaagtagaacctgcaaacaaatacccccagtgtctatgtctctccccaacgtatgagctcgccctccaaacaggaaaagtgattgaacaaatgggcaaattttaccctgaactgaagctagcttatgctgttcgaggcaataaattggaaagaggccagaagatcagtgagcagattgtcattggcacccctgggactgtgctggactggtgctccaagctcaagttcattgatcccaagaaaatcaaggtgtttgttctggatgaggctgatgtcatgatagccactcagggccaccaagatcagagcatccgcatccagaggatgctgcccaggaactgccagatgctgcttttctccgccacctttgaagactctgtgtggaagtttgcccagaaagtggtcccagacccaaacgttatcaaactgaagcgtgaggaagagaccctggacaccatcaagcagtactatgtcctgtgcagcagcagagacgagaagttccaggccttgtgtaacctctacggggccatcaccattgctcaagccatgatcttctgccatactcgcaaaacagctagttggctggcagcagagctctcaaaagaaggccaccaggtggctctgctgagtggggagatgatggtggaacagagggctgcagtgattgagcgcttccgagagggcaaagagaaggttttggtgaccaccaacgtgtgtgcccgcggcattgatgttgaacaagtgtctgtcgtcatcaactttgatcttcccgtggacaaggacgggaatcctgacaatgagacctacctgcaccggatcgggcgcacgggccgctttggcaagaggggcctggcagtgaacatggtggacagcaagcacagcatgaacatcctgaacagaatccaggagcattttaataagaagatagaaagattggacacagatgatttggacgagattgagaaaatagccaactga
Sequence Length
1440
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,063 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-As) box polypeptide 19B, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 19B
NCBI Official Symbol
DDX19B
NCBI Official Synonym Symbols
DBP5; RNAh; DDX19
NCBI Protein Information
ATP-dependent RNA helicase DDX19B
UniProt Protein Name
ATP-dependent RNA helicase DDX19B
UniProt Gene Name
DDX19B
UniProt Synonym Gene Names
DBP5; DDX19; TDBP
UniProt Entry Name
DD19B_HUMAN

NCBI Description

DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which exhibits RNA-dependent ATPase and ATP-dependent RNA-unwinding activities. This protein is recruited to the cytoplasmic fibrils of the nuclear pore complex, where it participates in the export of mRNA from the nucleus. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

DDX19B: ATP-dependent RNA helicase involved in mRNA export from the nucleus. Belongs to the DEAD box helicase family. DDX19/DBP5 subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.6.4.13; RNA-binding; Helicase

Chromosomal Location of Human Ortholog: 16q22.1

Cellular Component: cytoplasm; membrane; nucleus

Molecular Function: ATP-dependent RNA helicase activity; helicase activity; protein binding

Biological Process: mRNA export from nucleus; RNA secondary structure unwinding

Research Articles on DDX19B

Similar Products

Product Notes

The DDX19B ddx19b (Catalog #AAA1271592) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccactg actcatgggc cctggcggtg gacgagcagg aagctgcggc tgagtcgttg agcaacttgc atcttaagga agagaaaatc aaaccagata ccaatggtgc tgttgtcaag accaatgcca atgcagagaa gacagatgaa gaagagaaag aggacagagc tgcccagtcc ttactcaaca agctgatcag aagcaacctt gttgataaca caaaccaagt ggaagtcctg cagcgggatc caaactcccc tctgtactcg gtgaagtctt ttgaagagct tcggctgaaa ccacagcttc tccaaggagt ctatgccatg ggtttcaatc gtccatccaa gatacaagag aacgcattgc cactgatgct tgctgagccc ccacagaact taattgccca atctcagtct ggtactggta aaacagctgc cttcgtgctg gccatgctta gccaagtaga acctgcaaac aaataccccc agtgtctatg tctctcccca acgtatgagc tcgccctcca aacaggaaaa gtgattgaac aaatgggcaa attttaccct gaactgaagc tagcttatgc tgttcgaggc aataaattgg aaagaggcca gaagatcagt gagcagattg tcattggcac ccctgggact gtgctggact ggtgctccaa gctcaagttc attgatccca agaaaatcaa ggtgtttgtt ctggatgagg ctgatgtcat gatagccact cagggccacc aagatcagag catccgcatc cagaggatgc tgcccaggaa ctgccagatg ctgcttttct ccgccacctt tgaagactct gtgtggaagt ttgcccagaa agtggtccca gacccaaacg ttatcaaact gaagcgtgag gaagagaccc tggacaccat caagcagtac tatgtcctgt gcagcagcag agacgagaag ttccaggcct tgtgtaacct ctacggggcc atcaccattg ctcaagccat gatcttctgc catactcgca aaacagctag ttggctggca gcagagctct caaaagaagg ccaccaggtg gctctgctga gtggggagat gatggtggaa cagagggctg cagtgattga gcgcttccga gagggcaaag agaaggtttt ggtgaccacc aacgtgtgtg cccgcggcat tgatgttgaa caagtgtctg tcgtcatcaa ctttgatctt cccgtggaca aggacgggaa tcctgacaat gagacctacc tgcaccggat cgggcgcacg ggccgctttg gcaagagggg cctggcagtg aacatggtgg acagcaagca cagcatgaac atcctgaaca gaatccagga gcattttaat aagaagatag aaagattgga cacagatgat ttggacgaga ttgagaaaat agccaactga. It is sometimes possible for the material contained within the vial of "DDX19B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.