Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDIT4 cdna clone

DDIT4 cDNA Clone

Gene Names
DDIT4; Dig2; REDD1; REDD-1
Synonyms
DDIT4; DDIT4 cDNA Clone; DDIT4 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctagcctttgggaccgcttctcgtcgtcgtccacctcctcttcgccctcgtccttgccccgaactcccaccccagatcggccgccgcgctcagcctgggggtcggcgacccgggaggaggggtttgaccgctccacgagcctggagagctcggactgcgagtccctggacagcagcaacagtggcttcgggccggaggaagacacggcttacctggatggggtgtcgttgcccgacttcgagctgctcagtgaccctgaggatgaacacttgtgtgccaacctgatgcagctgctgcaggagagcctggcccaggcgcggctgggctctcgacgccctgcgcgcctgctgatgcctagccagttggtaagccaggtgggcaaagaactactgcgcctggcctacagcgagccgtgcggcctgcggggggcgctgctggacgtctgcgtggagcagggcaagagctgccacagcgtgggccagctggcactcgaccccagcctggtgcccaccttccagctgaccctcgtgctgcgcctggactcacgactctggcccaagatccaggggctgtttagctccgccaactctcccttcctccctggcttcagccagtccctgacgctgagcactggcttccgagtcatcaagaagaagctgtacagctcggaacagctgctcattgaggagtgttga
Sequence Length
699
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,371 Da
NCBI Official Full Name
Homo sapiens DNA-damage-inducible transcript 4, mRNA
NCBI Official Synonym Full Names
DNA damage inducible transcript 4
NCBI Official Symbol
DDIT4
NCBI Official Synonym Symbols
Dig2; REDD1; REDD-1
NCBI Protein Information
DNA damage-inducible transcript 4 protein
UniProt Protein Name
DNA damage-inducible transcript 4 protein
UniProt Gene Name
DDIT4
UniProt Synonym Gene Names
REDD1; RTP801; REDD-1
UniProt Entry Name
DDIT4_HUMAN

Uniprot Description

DDIT4: Inhibits cell growth by regulating the TOR signaling pathway upstream of the TSC1-TSC2 complex and downstream of AKT1. Promotes neuronal cell death. Up-regulated in fibroblasts upon ionizing radiation, via a TP53-dependent pathway. Up-regulated by TP63 in primary keratinocytes, and down-regulated during keratinocyte differentiation. Up-regulated upon DNA alkylation. Up-regulated by amyloid beta-peptide and retinoic acid. Up-regulated by hypoxia, via a PI3K and HIF1A-dependent but TP53/TP63-independent mechanism. Broadly expressed, with lowest levels in brain, skeletal muscle and intestine. Up-regulated in substantia nigra neurons from Parkinson disease patients. Belongs to the DDIT4 family.

Chromosomal Location of Human Ortholog: 10q22.1

Cellular Component: cytoplasm; cytosol; intracellular

Biological Process: brain development; cell proliferation; DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis; negative regulation of peptidyl-serine phosphorylation; negative regulation of TOR signaling pathway; nerve growth factor receptor signaling pathway; neuron differentiation; neuron migration; response to hypoxia

Research Articles on DDIT4

Similar Products

Product Notes

The DDIT4 ddit4 (Catalog #AAA1272814) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctagcc tttgggaccg cttctcgtcg tcgtccacct cctcttcgcc ctcgtccttg ccccgaactc ccaccccaga tcggccgccg cgctcagcct gggggtcggc gacccgggag gaggggtttg accgctccac gagcctggag agctcggact gcgagtccct ggacagcagc aacagtggct tcgggccgga ggaagacacg gcttacctgg atggggtgtc gttgcccgac ttcgagctgc tcagtgaccc tgaggatgaa cacttgtgtg ccaacctgat gcagctgctg caggagagcc tggcccaggc gcggctgggc tctcgacgcc ctgcgcgcct gctgatgcct agccagttgg taagccaggt gggcaaagaa ctactgcgcc tggcctacag cgagccgtgc ggcctgcggg gggcgctgct ggacgtctgc gtggagcagg gcaagagctg ccacagcgtg ggccagctgg cactcgaccc cagcctggtg cccaccttcc agctgaccct cgtgctgcgc ctggactcac gactctggcc caagatccag gggctgttta gctccgccaa ctctcccttc ctccctggct tcagccagtc cctgacgctg agcactggct tccgagtcat caagaagaag ctgtacagct cggaacagct gctcattgag gagtgttga. It is sometimes possible for the material contained within the vial of "DDIT4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.