Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DCUN1D4 cdna clone

DCUN1D4 cDNA Clone

Synonyms
DCUN1D4; DCUN1D4 cDNA Clone; DCUN1D4 cdna clone
Ordering
For Research Use Only!
Sequence
atgccaccaaggaaaaagagaagacctgcctctggagatgatttatctgccaagaaaagtagacatgatagcatgtatagaaaatatgattcgactagaataaagactgaagaagaagccttttcaagtaaaaggtgcttggaatggttctatgaatatgcaggaactgatgatgttgtaggccctgaaggcatggagaaattttgtgaagacattggtgttgaaccagaaaacgtagttatgcttgtcctagcttggaaattggatgcacaaaacatgggttattttactctacaggagtggttaaaaggaatgacttctctccaatgtgatacaacagaaaaactcagaaatactttggattacttaagatcattcttaaatgattctacaaactttaaacttatttacagatatgcgtttgactttgcacggcaatcaaaatacaaagttattaataaagaccagtggtgcaatgtcctagagtttagcagaacaattaatcttgacctcagcaactatgatgaagatggagcatggccagttttgttggacgagtttgtggagtggtataaagacaaacagatgtcctag
Sequence Length
594
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,382 Da
NCBI Official Full Name
Homo sapiens DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
defective in cullin neddylation 1 domain containing 4
NCBI Official Symbol
DCUN1D4
NCBI Protein Information
DCN1-like protein 4
UniProt Protein Name
DCN1-like protein 4
Protein Family
UniProt Gene Name
DCUN1D4
UniProt Synonym Gene Names
KIAA0276
UniProt Entry Name
DCNL4_HUMAN

Uniprot Description

DCUN1D4: 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 4q12

Cellular Component: nucleus; ubiquitin ligase complex

Molecular Function: protein binding; small conjugating protein binding; ubiquitin conjugating enzyme binding

Biological Process: positive regulation of ubiquitin-protein ligase activity; protein neddylation

Similar Products

Product Notes

The DCUN1D4 dcun1d4 (Catalog #AAA1270113) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccaccaa ggaaaaagag aagacctgcc tctggagatg atttatctgc caagaaaagt agacatgata gcatgtatag aaaatatgat tcgactagaa taaagactga agaagaagcc ttttcaagta aaaggtgctt ggaatggttc tatgaatatg caggaactga tgatgttgta ggccctgaag gcatggagaa attttgtgaa gacattggtg ttgaaccaga aaacgtagtt atgcttgtcc tagcttggaa attggatgca caaaacatgg gttattttac tctacaggag tggttaaaag gaatgacttc tctccaatgt gatacaacag aaaaactcag aaatactttg gattacttaa gatcattctt aaatgattct acaaacttta aacttattta cagatatgcg tttgactttg cacggcaatc aaaatacaaa gttattaata aagaccagtg gtgcaatgtc ctagagttta gcagaacaat taatcttgac ctcagcaact atgatgaaga tggagcatgg ccagttttgt tggacgagtt tgtggagtgg tataaagaca aacagatgtc ctag. It is sometimes possible for the material contained within the vial of "DCUN1D4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.