Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DBNL cdna clone

DBNL cDNA Clone

Gene Names
DBNL; ABP1; HIP55; SH3P7; HIP-55
Synonyms
DBNL; DBNL cDNA Clone; DBNL cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgaacctgagccggaacgggccagcgctgcaagaggcctacgtgcgggtggtcaccgagaagtccccgaccgactgggctctctttacctatgaaggcaacagcaatgacatccgcgtggctggcacaggggagggtggcctggaggagatggtggaggagctcaacagcgggaaggtgatgtacgccttctgcagagtgaaggaccccaactctggactgcccaaatttgtcctcatcaactggacaggcgagggcgtgaacgatgtgcggaagggagcctgtgccagccacgtcagcaccatggccagcttcctgaagggggcccatgtgaccatcaacgcacgggccgaggaggatgtggagcctgagtgcatcatggagaaggtggccaaggcttcaggtgccaactacagctttcacaaggagagtggccgcttccaggacgtgggaccccaggccccagtgggctctgtgtaccagaagaccaatgccgtgtctgagattaaaagggttggtaaagacagcttctgggccaaagcagagaaggaggaggagaaccgtcggctggaggaaaagcggcgggccgaggaggcacagcggcagctggagcaggagcgccgggagcgtgagctgcgtgaggctgcacgccgggagcagcgctatcaggagcagggtggcgaggccagcccccagaggacgtgggagcagcagcaagaagtggtttcaaggaaccgaaatgagcaggagtctgccgtgcacccgagggagattttcaagcagaaggagagggccatgtccaccacctccatctccagtcctcagcctggcaagctgaggagccccttcctgcagaagcagctcacccaaccagagacccactttggcagagagccagctgctgccatctcaaggcccagggcagatctccctgctgaggagccggcgcccagcactcctccatgtctggtgcaggcagaagaggaggctgtgtatgaggaacctccagagcaggagaccttctacgagcagcccccactggtgcagcagcaaggtgctggctctgagcacattgaccaccacattcagggccaggggctcagtgggcaagggctctgtgcccgtgccctgtacgactaccaggcagccgacgacacagagatctcctttgaccccgagaacctcatcacgggcatcgaggtgatcgacgaaggctggtggcgtggctatgggccggatggccattttggcatgttccctgccaactacgtggagctcattgagtga
Sequence Length
1293
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,041 Da
NCBI Official Full Name
Homo sapiens drebrin-like, mRNA
NCBI Official Synonym Full Names
drebrin like
NCBI Official Symbol
DBNL
NCBI Official Synonym Symbols
ABP1; HIP55; SH3P7; HIP-55
NCBI Protein Information
drebrin-like protein
UniProt Protein Name
Drebrin-like protein
Protein Family
UniProt Gene Name
DBNL
UniProt Synonym Gene Names
CMAP; SH3P7; HIP-55
UniProt Entry Name
DBNL_HUMAN

Uniprot Description

DBNL: an SH3-containing adaptor protein. Interacts with hematopoietic progenitor kinase 1a (HIPK1). It is recruited to glycolipid-enriched microdomains following T cell receptor (TCR) stimulation. Interacts with and is phosphorylated by ZAP-70 after TCR signaling. May regulate JNK activation following TCR signaling, presumably via its interaction with HIPKIt is a member of the drebrin family of proteins that are developmentally regulated in the brain.

Protein type: Actin-binding; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 7p13

Cellular Component: cell cortex; cell-cell adherens junction; cytoplasm; cytosol; lamellipodium; podosome; ruffle

Molecular Function: actin binding; actin filament binding; enzyme activator activity; protein binding

Biological Process: activation of JNK activity; neurite morphogenesis; Rac protein signal transduction; synaptogenesis

Research Articles on DBNL

Similar Products

Product Notes

The DBNL dbnl (Catalog #AAA1278063) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcga acctgagccg gaacgggcca gcgctgcaag aggcctacgt gcgggtggtc accgagaagt ccccgaccga ctgggctctc tttacctatg aaggcaacag caatgacatc cgcgtggctg gcacagggga gggtggcctg gaggagatgg tggaggagct caacagcggg aaggtgatgt acgccttctg cagagtgaag gaccccaact ctggactgcc caaatttgtc ctcatcaact ggacaggcga gggcgtgaac gatgtgcgga agggagcctg tgccagccac gtcagcacca tggccagctt cctgaagggg gcccatgtga ccatcaacgc acgggccgag gaggatgtgg agcctgagtg catcatggag aaggtggcca aggcttcagg tgccaactac agctttcaca aggagagtgg ccgcttccag gacgtgggac cccaggcccc agtgggctct gtgtaccaga agaccaatgc cgtgtctgag attaaaaggg ttggtaaaga cagcttctgg gccaaagcag agaaggagga ggagaaccgt cggctggagg aaaagcggcg ggccgaggag gcacagcggc agctggagca ggagcgccgg gagcgtgagc tgcgtgaggc tgcacgccgg gagcagcgct atcaggagca gggtggcgag gccagccccc agaggacgtg ggagcagcag caagaagtgg tttcaaggaa ccgaaatgag caggagtctg ccgtgcaccc gagggagatt ttcaagcaga aggagagggc catgtccacc acctccatct ccagtcctca gcctggcaag ctgaggagcc ccttcctgca gaagcagctc acccaaccag agacccactt tggcagagag ccagctgctg ccatctcaag gcccagggca gatctccctg ctgaggagcc ggcgcccagc actcctccat gtctggtgca ggcagaagag gaggctgtgt atgaggaacc tccagagcag gagaccttct acgagcagcc cccactggtg cagcagcaag gtgctggctc tgagcacatt gaccaccaca ttcagggcca ggggctcagt gggcaagggc tctgtgcccg tgccctgtac gactaccagg cagccgacga cacagagatc tcctttgacc ccgagaacct catcacgggc atcgaggtga tcgacgaagg ctggtggcgt ggctatgggc cggatggcca ttttggcatg ttccctgcca actacgtgga gctcattgag tga. It is sometimes possible for the material contained within the vial of "DBNL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.