Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DBC1 cdna clone

DBC1 cDNA Clone

Gene Names
BRINP1; DBC1; FAM5A; DBCCR1
Synonyms
DBC1; DBC1 cDNA Clone; DBC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaactggaggtttgttgagctcctctacttcctgtttatatggggccgtatctcagtgcagccctcccaccaggaaccagctgggacagaccaacatgtctccaaggaatttgattggctcatttcagacagggggcctttccaccactccaggagctacctatcctttgtggaaagacaccgtcaaggatttacaaccagatataaaatatacagggagtttgcccgttggaaggtgaggaacacagccatcgagaggagagatctggtccgccatccagtgcccctcatgccggagtttcaaaggagcatccgcctgcttggcaggagacctaccactcagcagttcatcgataccatcatcaaaaagtacggcacccacctgctcatctcagccacattgggaggggaggaggctttgaccatgtatatggacaaaagtcgcctcgacaggaagtcagggaatgccactcaaagtgttgaagctctgcaccagctcgcatcatcctactttgttgaccgtgatggtaccatgaggaggcttcatgagatccagatatcaactggagcaatcaaggtcacagagacacgcactgggcctctgggctgtaacagttatgacaatctggactctgtgagttccgtccttctgcaaagcacggagagcaaactgcaccttcaaggtcttcagataatctttcctcagtatctgcaagagaagtttgtccagtcggccttgagctatatcatgtgcaatggggagggggagtacctgtgccagaacagccagtgtcgctgccaatgtgccgaggagtttccgcagtgcaactgccccatcacggacatccagatcatggagtacacgctggccaacatggccaagtcttgggccgaagcttataaggacctggagaattcaggtagagagtctcactcagtgccactgcatgagtggccttga
Sequence Length
963
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,671 Da
NCBI Official Full Name
Homo sapiens deleted in bladder cancer 1, mRNA
NCBI Official Synonym Full Names
BMP/retinoic acid inducible neural specific 1
NCBI Official Symbol
BRINP1
NCBI Official Synonym Symbols
DBC1; FAM5A; DBCCR1
NCBI Protein Information
BMP/retinoic acid-inducible neural-specific protein 1
UniProt Protein Name
BMP/retinoic acid-inducible neural-specific protein 1
UniProt Gene Name
BRINP1
UniProt Synonym Gene Names
DBC1; DBCCR1; FAM5A
UniProt Entry Name
BRNP1_HUMAN

NCBI Description

This gene is located within a chromosomal region that shows loss of heterozygosity in some bladder cancers. It contains a 5' CpG island that may be a frequent target of hypermethylation, and it may undergo hypermethylation-based silencing in some bladder cancers. [provided by RefSeq, Jul 2008]

Uniprot Description

DBC1: Inhibits cell proliferation by negative regulation of the G1/S transition. Mediates cell death which is not of the classical apoptotic type and regulates expression of components of the plasminogen pathway. Belongs to the FAM5 family. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 9q32-q33

Cellular Component: cell soma; cytoplasm; dendrite; endoplasmic reticulum

Molecular Function: protein binding

Biological Process: cell death; negative regulation of cell cycle; negative regulation of mitotic cell cycle; positive regulation of neuron differentiation

Research Articles on DBC1

Similar Products

Product Notes

The DBC1 brinp1 (Catalog #AAA1275216) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaactgga ggtttgttga gctcctctac ttcctgttta tatggggccg tatctcagtg cagccctccc accaggaacc agctgggaca gaccaacatg tctccaagga atttgattgg ctcatttcag acagggggcc tttccaccac tccaggagct acctatcctt tgtggaaaga caccgtcaag gatttacaac cagatataaa atatacaggg agtttgcccg ttggaaggtg aggaacacag ccatcgagag gagagatctg gtccgccatc cagtgcccct catgccggag tttcaaagga gcatccgcct gcttggcagg agacctacca ctcagcagtt catcgatacc atcatcaaaa agtacggcac ccacctgctc atctcagcca cattgggagg ggaggaggct ttgaccatgt atatggacaa aagtcgcctc gacaggaagt cagggaatgc cactcaaagt gttgaagctc tgcaccagct cgcatcatcc tactttgttg accgtgatgg taccatgagg aggcttcatg agatccagat atcaactgga gcaatcaagg tcacagagac acgcactggg cctctgggct gtaacagtta tgacaatctg gactctgtga gttccgtcct tctgcaaagc acggagagca aactgcacct tcaaggtctt cagataatct ttcctcagta tctgcaagag aagtttgtcc agtcggcctt gagctatatc atgtgcaatg gggaggggga gtacctgtgc cagaacagcc agtgtcgctg ccaatgtgcc gaggagtttc cgcagtgcaa ctgccccatc acggacatcc agatcatgga gtacacgctg gccaacatgg ccaagtcttg ggccgaagct tataaggacc tggagaattc aggtagagag tctcactcag tgccactgca tgagtggcct tga. It is sometimes possible for the material contained within the vial of "DBC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.