Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DARS2 cdna clone

DARS2 cDNA Clone

Gene Names
DARS2; LBSL; ASPRS; MT-ASPRS
Synonyms
DARS2; DARS2 cDNA Clone; DARS2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtacttcccttcttggttaagtcagctgtacaggggtttatccagacccatcagaaggaccacccaaccgatctggggttctctctacagaagtctgttgcagagttcacagaggagaattccagaattcagtagctttgttgtccggaccaacacatgtggagagttgcgttcgtctcacttaggccaagaagtcaccttgtgtggatggattcagtaccgaaggcaaaacacattcttggtcctaagagatttcgatgggcttgttcaagttatcattccccaggatgagtcggcagcctctgtgaagaagattttatgtgaagcccctgtggaatctgtggtgcaagtgtctggtacagtcatttcccgtcctgcaggacaagagaatccaaaaatgccaacaggtgagattgaaatcaaagttaaaacagctgagcttctgaatgcctgcaagaagctgccctttgaaattaagaacttcgtgaagaaaacagaggctcttcggttgcagtatcgctacttagacttgcgtagtttccaaatgcagtataacctgcgactgaggtcccagatggtcatgaaaatgcgggaatatctctgtaatctgcatgggtttgtggatatagaaacccccacattgtttaagaggaccccagggggtgccaaagagtttttagtaccatccagggaacctggaaagttttattctctccctcagagtcctcaacagtttaagcaacttctgatggttggcggtttagacagatattttcaggttgcccgatgttatcgagatgaaggttcaagaccagacagacagcctgagtttactcagattgacatagagatgtcatttgtagaccagactgggatccagagtttaattgagggtttgctccagtattcctggcccaatgacaaagatcctgtggttgttccttttcctactatgacttttgctgaggtgctggccacctatggaactgataaacctgacactcgctttggaatgaagattatagatatcagtgatgtgtttagaaacacagagattggatttcttcaagatgcacttagtaagccccatggaactgtgaaagccatatgtatccctgaaggagcaaaatacttaaaaaggaaagacattgaatccattagaaactttgcagctgaccattttaatcaggaaatcttacctgtattccttaacgccaatagaaactggaattctccagttgctaatttcataatggagtcacaaagactggaattaatcagactaatggagacccaagaggaagatgtggtcctactaactgctggagagcacaataaagcatgctctttgttaggaaaattacgactggaatgtgctgaccttctagaaacaagaggagtggtgctccgtgaccccactctgttctctttcctttgggtggtagatttcccactcttcctgcccaaggaggaaaatcccagagagctggaatcggcccaccacccatttactgctccccaccccagtgacatacatctcctgtacactgagcccaaaaaggcccgtagccaacactatgacttggttttaaatggcaatgaaataggaggtggttcaattcgaattcacaatgcagagctgcagcgttatatcctggcaaccttactaaaggaggatgtgaaaatgctctcccatctgctccaggctttagattatggggcaccccctcatggaggaattgccttagggttagacagactgatatgccttgtcactggatctccaagcatcagagatgtcatagccttcccaaagtccttccggggacatgacctcatgagcaataccccagattctgtccctcctgaggaactgaagccctatcatatccgagtctccaagccaacagactccaaagcagaaagagctcattga
Sequence Length
1938
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
73,563 Da
NCBI Official Full Name
Homo sapiens aspartyl-tRNA synthetase 2, mitochondrial, mRNA
NCBI Official Synonym Full Names
aspartyl-tRNA synthetase 2, mitochondrial
NCBI Official Symbol
DARS2
NCBI Official Synonym Symbols
LBSL; ASPRS; MT-ASPRS
NCBI Protein Information
aspartate--tRNA ligase, mitochondrial
UniProt Protein Name
Aspartate--tRNA ligase, mitochondrial
UniProt Gene Name
DARS2
UniProt Synonym Gene Names
AspRS
UniProt Entry Name
SYDM_HUMAN

NCBI Description

The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. It is a mitochondrial enzyme that specifically aminoacylates aspartyl-tRNA. Mutations in this gene are associated with leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL). [provided by RefSeq, Nov 2009]

Uniprot Description

DARS2: Defects in DARS2 are a cause of leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL). LBSL is an autosomal recessive disease and is defined on the basis of a highly characteristic constellation of abnormalities observed by magnetic resonance imaging and spectroscopy. Affected individuals develop slowly progressive cerebellar ataxia, spasticity, and dorsal column dysfunction, sometimes with a mild cognitive deficit or decline. Belongs to the class-II aminoacyl-tRNA synthetase family.

Protein type: Translation; Mitochondrial; Ligase; EC 6.1.1.12

Chromosomal Location of Human Ortholog: 1q25.1

Cellular Component: mitochondrial matrix; mitochondrion; nucleus

Molecular Function: aspartate-tRNA ligase activity; aspartate-tRNA(Asn) ligase activity; ATP binding; protein binding; protein homodimerization activity; tRNA binding

Biological Process: tRNA aminoacylation; tRNA aminoacylation for protein translation

Disease: Leukoencephalopathy With Brainstem And Spinal Cord Involvement And Lactate Elevation

Research Articles on DARS2

Similar Products

Product Notes

The DARS2 dars2 (Catalog #AAA1266905) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacttcc cttcttggtt aagtcagctg tacaggggtt tatccagacc catcagaagg accacccaac cgatctgggg ttctctctac agaagtctgt tgcagagttc acagaggaga attccagaat tcagtagctt tgttgtccgg accaacacat gtggagagtt gcgttcgtct cacttaggcc aagaagtcac cttgtgtgga tggattcagt accgaaggca aaacacattc ttggtcctaa gagatttcga tgggcttgtt caagttatca ttccccagga tgagtcggca gcctctgtga agaagatttt atgtgaagcc cctgtggaat ctgtggtgca agtgtctggt acagtcattt cccgtcctgc aggacaagag aatccaaaaa tgccaacagg tgagattgaa atcaaagtta aaacagctga gcttctgaat gcctgcaaga agctgccctt tgaaattaag aacttcgtga agaaaacaga ggctcttcgg ttgcagtatc gctacttaga cttgcgtagt ttccaaatgc agtataacct gcgactgagg tcccagatgg tcatgaaaat gcgggaatat ctctgtaatc tgcatgggtt tgtggatata gaaaccccca cattgtttaa gaggacccca gggggtgcca aagagttttt agtaccatcc agggaacctg gaaagtttta ttctctccct cagagtcctc aacagtttaa gcaacttctg atggttggcg gtttagacag atattttcag gttgcccgat gttatcgaga tgaaggttca agaccagaca gacagcctga gtttactcag attgacatag agatgtcatt tgtagaccag actgggatcc agagtttaat tgagggtttg ctccagtatt cctggcccaa tgacaaagat cctgtggttg ttccttttcc tactatgact tttgctgagg tgctggccac ctatggaact gataaacctg acactcgctt tggaatgaag attatagata tcagtgatgt gtttagaaac acagagattg gatttcttca agatgcactt agtaagcccc atggaactgt gaaagccata tgtatccctg aaggagcaaa atacttaaaa aggaaagaca ttgaatccat tagaaacttt gcagctgacc attttaatca ggaaatctta cctgtattcc ttaacgccaa tagaaactgg aattctccag ttgctaattt cataatggag tcacaaagac tggaattaat cagactaatg gagacccaag aggaagatgt ggtcctacta actgctggag agcacaataa agcatgctct ttgttaggaa aattacgact ggaatgtgct gaccttctag aaacaagagg agtggtgctc cgtgacccca ctctgttctc tttcctttgg gtggtagatt tcccactctt cctgcccaag gaggaaaatc ccagagagct ggaatcggcc caccacccat ttactgctcc ccaccccagt gacatacatc tcctgtacac tgagcccaaa aaggcccgta gccaacacta tgacttggtt ttaaatggca atgaaatagg aggtggttca attcgaattc acaatgcaga gctgcagcgt tatatcctgg caaccttact aaaggaggat gtgaaaatgc tctcccatct gctccaggct ttagattatg gggcaccccc tcatggagga attgccttag ggttagacag actgatatgc cttgtcactg gatctccaag catcagagat gtcatagcct tcccaaagtc cttccgggga catgacctca tgagcaatac cccagattct gtccctcctg aggaactgaa gccctatcat atccgagtct ccaagccaac agactccaaa gcagaaagag ctcattga. It is sometimes possible for the material contained within the vial of "DARS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.