DARS cdna clone
DARS cDNA Clone
Gene Names
DARS; HBSL; aspRS
Synonyms
DARS; DARS cDNA Clone; DARS cdna clone
Sequence
atgcccagcgccagcgccagccgcaagagtcaggagaagccgcgggagatcatggacgcggcggaagattatgctaaagagagatatggaatatcttcaatgatacaatcacaagaaaaaccagatcgagttttggttcgggttagagacttgacaatacaaaaagctgatgaagttgtttgggtacgtgcaagagttcatacaagcagagctaaagggaaacagtgcttcttagtcctacgtcagcagcagtttaatgtccaggctcttgtggcggtgggagaccatgcaagcaagcagatggttaaatttgctgccaacatcaacaaagagagcattgtggatgtagaaggtgttgtgagaaaagtgaatcagaaaattggaagctgtacacagcaagacgttgagttacatgttcagaagatttatgtgatcagtttggctgaaccccgtctgcccctgcagctggatgatgctgttcggcctgaggcagaaggagaagaggaaggaagagctactgttaaccaggatacaagattagacaacagagtcattgatcttaggacatcaactagtcaggcagtcttccgtctccagtctggcatctgccatctcttccgagaaactttaattaacaaaggttttgtggaaatccaaactcctaaaattatttcagctgccagtgaaggaggagccaatgtttttactgtgtcatattttaaaaataatgcatacctggctcagtccccacagctatataagcaaatgtgcatttgtgctgattttgagaaggttttctctattggaccagtattcagagcggaagactctaatacccatagacatctaactgagtttgttggtttggacattgaaatggcttttaattaccattaccacgaagttatggaagaaattgctgacaccatggtacaaatattcaaaggacttcaagaaaggtttcagactgaaattcaaacagtgaataaacagttcccatgtgagccattcaaatttttggagccaactctaagactagaatattgtgaagcattggctatgcttagggaagctggagtcgaaatgggagatgaagacgatctgagcacaccaaatgaaaagctgttgggtcatttggtaaaggaaaagtatgatacagatttttatattcttgataaatatccattggctgtaagacctttctataccatgcctgacccaagaaatcccaaacagtccaactcttacgatatgttcatgagaggagaagaaatattgtcaggagctcaaagaatacatgatcctcaactgctaacagagagagctttacatcatggaattgatttggagaaaattaaggcttacattgattccttccgctttggagcccctcctcatgctggtggaggcattggattggaacgagttactatgctgtttctgggattgcataatgttcgtcagacctccatgttccctcgtgatcccaaacgactcactccttaa
Sequence Length
1506
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
45,771 Da
NCBI Official Full Name
Homo sapiens aspartyl-tRNA synthetase, mRNA
NCBI Official Synonym Full Names
aspartyl-tRNA synthetase
NCBI Official Symbol
DARS
NCBI Official Synonym Symbols
HBSL; aspRS
NCBI Protein Information
aspartate--tRNA ligase, cytoplasmic
UniProt Protein Name
Aspartate--tRNA ligase, cytoplasmic
UniProt Gene Name
DARS
UniProt Synonym Gene Names
AspRS
UniProt Entry Name
SYDC_HUMAN
NCBI Description
This gene encodes a member of a multienzyme complex that functions in mediating the attachment of amino acids to their cognate tRNAs. The encoded protein ligates L-aspartate to tRNA(Asp). Mutations in this gene have been found in patients showing hypomyelination with brainstem and spinal cord involvement and leg spasticity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Uniprot Description
DARS: Catalyzes the specific attachment of an amino acid to its cognate tRNA in a 2 step reaction: the amino acid (AA) is first activated by ATP to form AA-AMP and then transferred to the acceptor end of the tRNA. Belongs to the class-II aminoacyl-tRNA synthetase family.
Protein type: Translation; Ligase; EC 6.1.1.12
Chromosomal Location of Human Ortholog: 2q21.3
Cellular Component: cytoplasm; cytosol; membrane
Molecular Function: aminoacylase activity; protein binding
Biological Process: protein complex assembly; translation; tRNA aminoacylation for protein translation
Disease: Hypomyelination With Brainstem And Spinal Cord Involvement And Leg Spasticity
Research Articles on DARS
Similar Products
Product Notes
The DARS dars (Catalog #AAA1275476) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccagcg ccagcgccag ccgcaagagt caggagaagc cgcgggagat catggacgcg gcggaagatt atgctaaaga gagatatgga atatcttcaa tgatacaatc acaagaaaaa ccagatcgag ttttggttcg ggttagagac ttgacaatac aaaaagctga tgaagttgtt tgggtacgtg caagagttca tacaagcaga gctaaaggga aacagtgctt cttagtccta cgtcagcagc agtttaatgt ccaggctctt gtggcggtgg gagaccatgc aagcaagcag atggttaaat ttgctgccaa catcaacaaa gagagcattg tggatgtaga aggtgttgtg agaaaagtga atcagaaaat tggaagctgt acacagcaag acgttgagtt acatgttcag aagatttatg tgatcagttt ggctgaaccc cgtctgcccc tgcagctgga tgatgctgtt cggcctgagg cagaaggaga agaggaagga agagctactg ttaaccagga tacaagatta gacaacagag tcattgatct taggacatca actagtcagg cagtcttccg tctccagtct ggcatctgcc atctcttccg agaaacttta attaacaaag gttttgtgga aatccaaact cctaaaatta tttcagctgc cagtgaagga ggagccaatg tttttactgt gtcatatttt aaaaataatg catacctggc tcagtcccca cagctatata agcaaatgtg catttgtgct gattttgaga aggttttctc tattggacca gtattcagag cggaagactc taatacccat agacatctaa ctgagtttgt tggtttggac attgaaatgg cttttaatta ccattaccac gaagttatgg aagaaattgc tgacaccatg gtacaaatat tcaaaggact tcaagaaagg tttcagactg aaattcaaac agtgaataaa cagttcccat gtgagccatt caaatttttg gagccaactc taagactaga atattgtgaa gcattggcta tgcttaggga agctggagtc gaaatgggag atgaagacga tctgagcaca ccaaatgaaa agctgttggg tcatttggta aaggaaaagt atgatacaga tttttatatt cttgataaat atccattggc tgtaagacct ttctatacca tgcctgaccc aagaaatccc aaacagtcca actcttacga tatgttcatg agaggagaag aaatattgtc aggagctcaa agaatacatg atcctcaact gctaacagag agagctttac atcatggaat tgatttggag aaaattaagg cttacattga ttccttccgc tttggagccc ctcctcatgc tggtggaggc attggattgg aacgagttac tatgctgttt ctgggattgc ataatgttcg tcagacctcc atgttccctc gtgatcccaa acgactcact ccttaa. It is sometimes possible for the material contained within the vial of "DARS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
