Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CYP19A1 cdna clone

CYP19A1 cDNA Clone

Gene Names
CYP19A1; ARO; ARO1; CPV1; CYAR; CYP19; CYPXIX; P-450AROM
Synonyms
CYP19A1; CYP19A1 cDNA Clone; CYP19A1 cdna clone
Ordering
For Research Use Only!
Sequence
atggttttggaaatgctgaacccgatacattataacatcaccagcatcgtgcctgaagccatgcctgctgccaccatgccagtcctgctcctcactggcctttttctcttggtgtggaattatgagggcacatcctcaataccaggtcctggctactgcatgggaattggacccctcatctcccacggcagattcctgtggatggggatcggcagtgcctgcaactactacaaccgggtatatggagaattcatgcgagtctggatctctggagaggaaacactcattatcagcaagtcctcaagtatgttccacataatgaagcacaatcattacagctctcgattcggcagcaaacttgggctgcagtgcatcggtatgcatgagaaaggcatcatatttaacaacaatccagagctctggaaaacaactcgacccttctttatgaaagctctgtcaggccccggccttgttcgtatggtcacagtctgtgctgaatccctcaaaacacatctggacaggttggaggaggtgaccaatgaatcgggctatgtggacgtgttgacccttctgcgtcgtgtcatgctggacacctctaacacgctcttcttgaggatccctttggacggtactgaaattttcactctcacatcttga
Sequence Length
657
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,518 Da
NCBI Official Full Name
Homo sapiens cytochrome P450, family 19, subfamily A, polypeptide 1, mRNA
NCBI Official Synonym Full Names
cytochrome P450 family 19 subfamily A member 1
NCBI Official Symbol
CYP19A1
NCBI Official Synonym Symbols
ARO; ARO1; CPV1; CYAR; CYP19; CYPXIX; P-450AROM
NCBI Protein Information
aromatase
UniProt Protein Name
Aromatase
Protein Family
UniProt Gene Name
CYP19A1
UniProt Synonym Gene Names
ARO1; CYAR; CYP19
UniProt Entry Name
CP19A_HUMAN

NCBI Description

This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and catalyzes the last steps of estrogen biosynthesis. Mutations in this gene can result in either increased or decreased aromatase activity; the associated phenotypes suggest that estrogen functions both as a sex steroid hormone and in growth or differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]

Uniprot Description

CYP19A1: Catalyzes the formation of aromatic C18 estrogens from C19 androgens. Belongs to the cytochrome P450 family.

Protein type: Oxidoreductase; EC 1.14.14.14; Lipid Metabolism - androgen and estrogen

Chromosomal Location of Human Ortholog: 15q21.1

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; membrane

Molecular Function: electron carrier activity; heme binding; oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen; oxygen binding; steroid hydroxylase activity

Biological Process: estrogen biosynthetic process; steroid biosynthetic process; sterol metabolic process

Disease: Aromatase Deficiency; Aromatase Excess Syndrome

Research Articles on CYP19A1

Similar Products

Product Notes

The CYP19A1 cyp19a1 (Catalog #AAA1270590) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggttttgg aaatgctgaa cccgatacat tataacatca ccagcatcgt gcctgaagcc atgcctgctg ccaccatgcc agtcctgctc ctcactggcc tttttctctt ggtgtggaat tatgagggca catcctcaat accaggtcct ggctactgca tgggaattgg acccctcatc tcccacggca gattcctgtg gatggggatc ggcagtgcct gcaactacta caaccgggta tatggagaat tcatgcgagt ctggatctct ggagaggaaa cactcattat cagcaagtcc tcaagtatgt tccacataat gaagcacaat cattacagct ctcgattcgg cagcaaactt gggctgcagt gcatcggtat gcatgagaaa ggcatcatat ttaacaacaa tccagagctc tggaaaacaa ctcgaccctt ctttatgaaa gctctgtcag gccccggcct tgttcgtatg gtcacagtct gtgctgaatc cctcaaaaca catctggaca ggttggagga ggtgaccaat gaatcgggct atgtggacgt gttgaccctt ctgcgtcgtg tcatgctgga cacctctaac acgctcttct tgaggatccc tttggacggt actgaaattt tcactctcac atcttga. It is sometimes possible for the material contained within the vial of "CYP19A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.