Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CYP11A1 cdna clone

CYP11A1 cDNA Clone

Gene Names
CYP11A1; CYP11A; CYPXIA1; P450SCC
Synonyms
CYP11A1; CYP11A1 cDNA Clone; CYP11A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctggccaagggtcttcccccacgctcagtcctggtcaaaggctgccagacctttctgagtgcccccagggaggggctggggcgtctcagggtgcccactggcgagggagctggcatctccacccgcagtcctcgccccttcaatgagatcccctctcctggtgacaatggctggctaaacctgtaccatttctggagggagacgggcacacacaaagtccaccttcaccatgtccagaatttccagaagtatggcccgatttacagggagaagctcggcaacgtggagtcggtttatgtcatcgaccctgaagatgtggcccttctctttaagtccgagggccccaacccagaacgattcctcatcccgccctgggtcgcctatcaccagtattaccagagacccataggagtcctgttgaagaagtcggcagcctggaagaaagaccgggtggccctgaaccaggaggtgatggctccagaggccaccaagaactttttgcccctgttggatgcagtgtctcgggacttcgtcagtgtcctgcacaggcgcatcaagaaggcgggctccggaaattactcgggggacatcagtgatgacctgttccgctttgcctttgagtccatcactaacgtcatttttggggagcgccaggggatgctggaggaagtagtgaaccccgaggcccagcgattcattgatgccatctaccagatgttccacaccagcgtccccatgctcaaccttcccccagacctgttccgtctgttcaggaccaagacctggaaggaccatgtggctgcatgggacgtgattttcagtaaagctgacatatacacccagaacttctactgggaattgagacagaaaggaagtgttcaccacgattaccgtggcatcctctacagactcctgggagacagcaagatgtccttcgaggacatcaaggccaacgtcacagagatgctggcaggaggggtggacacgacgtccatgaccctgcagtggcacttgtatgagatggcacgcaacctgaaggtgcaggatatgctgcgggcagaggtcttggctgcgcggcaccaggcccagggagacatggccacgatgctacagctggtccccctcctcaaagccagcatcaaggagacactaagacttcaccccatctccgtgaccctgcagagatatcttgtaaatgacttggttcttcgagattacatgattcctgccaagacactggtgcaagtggccatctatgctctgggccgagagcccaccttcttcttcgacccggaaaattttgacccaacccgatggctgagcaaagacaagaacatcacctacttccggaacttgggctttggctggggtgtgcggcagtgtctgggacggcggatcgctgagctagagatgaccatcttcctcatcaatatgctggagaacttcagagttgaaatccaacacctcagcgatgtgggcaccacattcaacctcattctgatgcctgaaaagcccatctccttcaccttctggccctttaaccaggaagcaacccagcagtga
Sequence Length
1566
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,152 Da
NCBI Official Full Name
Homo sapiens cytochrome P450, family 11, subfamily A, polypeptide 1, mRNA
NCBI Official Synonym Full Names
cytochrome P450 family 11 subfamily A member 1
NCBI Official Symbol
CYP11A1
NCBI Official Synonym Symbols
CYP11A; CYPXIA1; P450SCC
NCBI Protein Information
cholesterol side-chain cleavage enzyme, mitochondrial
UniProt Protein Name
Cholesterol side-chain cleavage enzyme, mitochondrial
UniProt Gene Name
CYP11A1
UniProt Synonym Gene Names
CYP11A
UniProt Entry Name
CP11A_HUMAN

NCBI Description

This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and catalyzes the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones. Two transcript variants encoding different isoforms have been found for this gene. The cellular location of the smaller isoform is unclear since it lacks the mitochondrial-targeting transit peptide. [provided by RefSeq, Jul 2008]

Uniprot Description

CYP11A1: Catalyzes the side-chain cleavage reaction of cholesterol to pregnenolone. Defects in CYP11A1 are the cause of adrenal insufficiency congenital with 46,XY sex reversal (AICSR). A rare disorder that can present as acute adrenal insufficiency in infancy or childhood. ACTH and plasma renin activity are elevated and adrenal steroids are inappropriately low or absent; the 46,XY patients have female external genitalia, sometimes with clitoromegaly. The phenotypic spectrum ranges from prematurity, complete underandrogenization, and severe early-onset adrenal failure to term birth with clitoromegaly and later-onset adrenal failure. Patients with congenital adrenal insufficiency do not manifest the massive adrenal enlargement typical of congenital lipoid adrenal hyperplasia. Belongs to the cytochrome P450 family.

Protein type: Lipid Metabolism - C21-steroid hormone; EC 1.14.15.6; Oxidoreductase; Mitochondrial

Chromosomal Location of Human Ortholog: 15q23-q24

Cellular Component: mitochondrial inner membrane; mitochondrial matrix; mitochondrion

Molecular Function: cholesterol monooxygenase (side-chain-cleaving) activity; heme binding; oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen

Biological Process: C21-steroid hormone biosynthetic process; cholesterol metabolic process; glucocorticoid biosynthetic process; sterol metabolic process; vitamin D metabolic process

Disease: Adrenal Insufficiency, Congenital, With 46,xy Sex Reversal, Partial Or Complete

Research Articles on CYP11A1

Similar Products

Product Notes

The CYP11A1 cyp11a1 (Catalog #AAA1269283) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggcca agggtcttcc cccacgctca gtcctggtca aaggctgcca gacctttctg agtgccccca gggaggggct ggggcgtctc agggtgccca ctggcgaggg agctggcatc tccacccgca gtcctcgccc cttcaatgag atcccctctc ctggtgacaa tggctggcta aacctgtacc atttctggag ggagacgggc acacacaaag tccaccttca ccatgtccag aatttccaga agtatggccc gatttacagg gagaagctcg gcaacgtgga gtcggtttat gtcatcgacc ctgaagatgt ggcccttctc tttaagtccg agggccccaa cccagaacga ttcctcatcc cgccctgggt cgcctatcac cagtattacc agagacccat aggagtcctg ttgaagaagt cggcagcctg gaagaaagac cgggtggccc tgaaccagga ggtgatggct ccagaggcca ccaagaactt tttgcccctg ttggatgcag tgtctcggga cttcgtcagt gtcctgcaca ggcgcatcaa gaaggcgggc tccggaaatt actcggggga catcagtgat gacctgttcc gctttgcctt tgagtccatc actaacgtca tttttgggga gcgccagggg atgctggagg aagtagtgaa ccccgaggcc cagcgattca ttgatgccat ctaccagatg ttccacacca gcgtccccat gctcaacctt cccccagacc tgttccgtct gttcaggacc aagacctgga aggaccatgt ggctgcatgg gacgtgattt tcagtaaagc tgacatatac acccagaact tctactggga attgagacag aaaggaagtg ttcaccacga ttaccgtggc atcctctaca gactcctggg agacagcaag atgtccttcg aggacatcaa ggccaacgtc acagagatgc tggcaggagg ggtggacacg acgtccatga ccctgcagtg gcacttgtat gagatggcac gcaacctgaa ggtgcaggat atgctgcggg cagaggtctt ggctgcgcgg caccaggccc agggagacat ggccacgatg ctacagctgg tccccctcct caaagccagc atcaaggaga cactaagact tcaccccatc tccgtgaccc tgcagagata tcttgtaaat gacttggttc ttcgagatta catgattcct gccaagacac tggtgcaagt ggccatctat gctctgggcc gagagcccac cttcttcttc gacccggaaa attttgaccc aacccgatgg ctgagcaaag acaagaacat cacctacttc cggaacttgg gctttggctg gggtgtgcgg cagtgtctgg gacggcggat cgctgagcta gagatgacca tcttcctcat caatatgctg gagaacttca gagttgaaat ccaacacctc agcgatgtgg gcaccacatt caacctcatt ctgatgcctg aaaagcccat ctccttcacc ttctggccct ttaaccagga agcaacccag cagtga. It is sometimes possible for the material contained within the vial of "CYP11A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.