Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CYGB cdna clone

CYGB cDNA Clone

Gene Names
CYGB; HGB; STAP
Synonyms
CYGB; CYGB cDNA Clone; CYGB cdna clone
Ordering
For Research Use Only!
Sequence
atggagaaagtgccaggcgagatggagatcgagcgcagggagcggagcgaggagctgtccgaggcggagaggaaggcggtgcaggctatgtgggcccggctctatgccagctgcgaggacgtgggggtggccatcctggtgaggttctttgtgaacttcccctcggccaagcagtacttcagccagttcaagcacatggaggatcccctggagatggagcggagcccccagctgcggaagcacgcctgccgagtcatgggggccctcaacactgtcgtggagaacctgcatgaccccgacaaggtgtcctctgtgctcgcccttgtggggaaagcccacgccctcaagcacaaggtggaaccggtgtacttcaagatcctctctggggtcattctggaggtggtcgccgaggaatttgccagtgacttcccacctgagacgcagagagcctgggccaagctgcgtggcctcatctacagccacgtgaccgctgcctacaaggaagtgggctgggtgcagcaggtccccaacgccaccaccccaccggccacactgccctcttcggggccgtag
Sequence Length
573
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,405 Da
NCBI Official Full Name
Homo sapiens cytoglobin, mRNA
NCBI Official Synonym Full Names
cytoglobin
NCBI Official Symbol
CYGB
NCBI Official Synonym Symbols
HGB; STAP
NCBI Protein Information
cytoglobin
UniProt Protein Name
Cytoglobin
Protein Family
UniProt Gene Name
CYGB
UniProt Synonym Gene Names
STAP; HGb
UniProt Entry Name
CYGB_HUMAN

NCBI Description

This gene encodes a globin protein found in vertebrate cells. The encoded protein is described as a hexacoordinate hemoglobin which binds ligand differently from the pentacoordinate hemoglobins involved in oxygen transport, and may be involved in protection during oxidative stress. This gene is located on chromosome 17 in the same region as a retinal gene which is mutated in progressive rod-cone degeneration, but in the opposite orientation. [provided by RefSeq, Jan 2012]

Uniprot Description

CYGB: May have a protective function during conditions of oxidative stress. May be involved in intracellular oxygen storage or transfer. Belongs to the globin family.

Chromosomal Location of Human Ortholog: 17q25

Cellular Component: cytosol

Molecular Function: nitric oxide dioxygenase activity; peroxidase activity; protein binding

Biological Process: regulation of nitric-oxide synthase activity; response to oxidative stress

Research Articles on CYGB

Similar Products

Product Notes

The CYGB cygb (Catalog #AAA1271918) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaaag tgccaggcga gatggagatc gagcgcaggg agcggagcga ggagctgtcc gaggcggaga ggaaggcggt gcaggctatg tgggcccggc tctatgccag ctgcgaggac gtgggggtgg ccatcctggt gaggttcttt gtgaacttcc cctcggccaa gcagtacttc agccagttca agcacatgga ggatcccctg gagatggagc ggagccccca gctgcggaag cacgcctgcc gagtcatggg ggccctcaac actgtcgtgg agaacctgca tgaccccgac aaggtgtcct ctgtgctcgc ccttgtgggg aaagcccacg ccctcaagca caaggtggaa ccggtgtact tcaagatcct ctctggggtc attctggagg tggtcgccga ggaatttgcc agtgacttcc cacctgagac gcagagagcc tgggccaagc tgcgtggcct catctacagc cacgtgaccg ctgcctacaa ggaagtgggc tgggtgcagc aggtccccaa cgccaccacc ccaccggcca cactgccctc ttcggggccg tag. It is sometimes possible for the material contained within the vial of "CYGB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.