Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CYFIP2 cdna clone

CYFIP2 cDNA Clone

Gene Names
CYFIP2; PIR121
Synonyms
CYFIP2; CYFIP2 cDNA Clone; CYFIP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccacgcacgtcaccctggaagatgccctgtccaacgtggacctgcttgaagagcttcccctccccgaccagcagccatgcatcgagcctccaccttcctccatcatgtaccaggctaactttgacacaaactttgaggacaggaatgcatttgtcacgggcattgcaaggtacattgagcaggctacagtccactccagcatgaatgagatgctggaggaaggacatgagtatgcggtcatgctgtacacctggcgcagctgttcccgggccattccccaggtgaaatgcaacgagcagcccaaccgagtagagatctatgagaagacagtagaggtgctggagccggaggtcaccaagctcatgaagttcatgtattttcagcgcaaggccatcgagcggttctgcagcgaggtgaagcggctgtgccatgccgagcgcaggaaggactttgtctctgaggcctacctcctgacccttggcaagttcatcaacatgtttgctgtcctggatgagctaaagaacatgaagtgcagcgtcaagaatgaccactctgcctacaagagggcagcacagttcctgcggaagatggcagatccccagtctatccaggagtcgcagaacctttccatgttcctggccaaccacaacaggatcacccagtgtctccaccagcaacttgaagtgatcccaggctatgaggagctgctggctgacattgtcaacatctgtgtggattactacgagaacaagatgtacctgactcccagtgagaaacatatgctcctcaaggtgatgggctttggcctctacctaatggatggaaatgtcagtaacatttacaaactggatgccaagaagagaattaatcttagcaaaattgataaattctttaagcagctgcaggtggtgccccttttcggcgacatgcagatagagctggccagatacattaagaccagtgctcactatgaagagaacaagtccaagtggacgtgcacccagagcagcatcagcccccagtacaatatctgcgagcagatggttcagatccgggatgaccacatccgcttcatctccgagctcgctcgctacagcaacagtgaggtggtgacgggctcagggctggacagccagaagtcagacgaggagtatcgcgagctcttcgacctagccctgcggggtctgcagcttctatccaagtggagcgcccacgtcatggaggtgtactcttggaagctggttcatcccacagacaagttctgcaacaaggactgtcctggcaccgcggaggaatatgagagagccacacgctacaattacaccagtgaggaaaaatttgccttcgttgaggtgatcgccatgatcaaaggcctgcaggtgctcatgggcaggatggagagcgtcttcaaccaggccatcaggaacaccatctacgcggcattgcaggacttcgcccaggtgacgctgcgtgagcccctgcggcaggcggtacggaagaagaagaatgtcctcatcagcgtcctacaggcaattcgaaagaccatctgtgactgggagggagggcgagagccccctaatgacccatgcttgagaggggagaaggaccccaaaggtggatttgatatcaaggtgccccggcgtgctgtggggccatccagcacacagctgtacatggtgcggaccatgcttgaatcactcattgcagacaaaagcggctccaagaagaccctgaggagcagcctggatggacccattgtcctcgccatagaggactttcacaaacagtccttcttcttcacacatctgctcaacatcagtgaagccctgcagcagtgttgtgacctctcccagctctggttccgagaattcttcctggagttaaccatgggccgacgaatccagttccccatcgagatgtccatgccctggattctaacggaccatatcctggaaaccaaagaaccttccatgatggagtatgtcctctaccctctggatctgtacaacgacagcgcctactatgctctgaccaagtttaaaaagcagttcctgtacgatgagatagaagctgaggtgaacctgtgttttgatcagtttgtctacaagctggcagaccagatctttgcttactacaaagccatggctggcagtgtcctgttggataaacgttttcgagctgagtgtaagaattatggcgtcatcattccgtatccaccgtccaatcgctatgaaacactgctgaagcagagacacgtccagctgttgggtagatcaattgacttgaacagactcattacccagcgcacctctgccgccatgtataaatccttggaccaagctatcagccgctttgagagtgaggacctgacctccattgtggagctggagtggctgctggagattaaccggctcacgcatcggctgctctgtaagcatatgacgctggacagcttcgatgccatgttccgagaggccaatcacaatgtgtccgccccctatggccgtatcaccctgcatgtcttctgggaactgaactttgactttctccccaactactgctacaatgggtccactaaccgttttgtgcggactgccattcctttcacccaagaaccacaacgagacaaacctgccaacgtccagccttattacctctatggatccaagcctctcaacattgcctacagccacatctacagctcctacaggaatttcgtggggccacctcatttcaagactatctgcagactcctgggttatcagggcatcgctgtggtcatggaggaactgctaaagattgtgaagagcttgctccaaggaaccattctccagtatgtgaaaacactgatagaggtgatgcccaagatatgccgcttgccccgacatgagtatggctccccagggatcctggagttcttccaccaccagctgaaggacatcattgagtacgcagagctcaaaacagacgtgttccagagcctgagggaagtgggcaatgccatcctcttctgcctcctcatagagcaagctctgtctcaggaggaggtctgcgatttgctccatgccgcacccttccaaaacatcttgcctagagtctacatcaaagagggggagcgcctggaggtccggatgaaacgtctggaagccaagtatgccccgctccacctggtccctctgatcgagcggctggggacccctcagcaaatcgccattgctcgcgagggtgacctcctgaccaaggagcggctgtgctgtggcctgtccatgttcgaggtcatcctgacccgcattcggagctacctgcaggaccccatctggcggggcccaccgcccaccaatggcgtcatgcacgtcgatgagtgtgtggagttccaccggctgtggagcgccatgcagttcgtgtactgcatccctgtgggaaccaacgagttcacagctgagcagtgtttcggcgatggcttgaactgggctggttgctccatcattgtcctgctgggccagcagcgtcgctttgacctgttcgacttctgttaccacctgctaaaagtgcagaggcaggacgggaaggatgaaatcattaagaatgtgcccctgaagaagatggccgaccggatcaggaagtatcagatcttgaacaatgaggtttttgccatcctgaacaaatacatgaagtccgtggagacagacagttccactgtggagcatgtgcgctgcttccagccacccatccaccagtccttggccaccacttgctaa
Sequence Length
3762
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
145,673 Da
NCBI Official Full Name
Homo sapiens cytoplasmic FMR1 interacting protein 2, mRNA
NCBI Official Synonym Full Names
cytoplasmic FMR1 interacting protein 2
NCBI Official Symbol
CYFIP2
NCBI Official Synonym Symbols
PIR121
NCBI Protein Information
cytoplasmic FMR1-interacting protein 2
UniProt Protein Name
Cytoplasmic FMR1-interacting protein 2
UniProt Gene Name
CYFIP2
UniProt Entry Name
CYFP2_HUMAN

Uniprot Description

CYFIP2: Involved in T-cell adhesion and p53/TP53-dependent induction of apoptosis. Does not bind RNA. Belongs to the CYFIP family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Cell adhesion

Chromosomal Location of Human Ortholog: 5q33.3

Cellular Component: cytoplasm; cytosol; membrane; perinuclear region of cytoplasm; synapse

Molecular Function: protein binding

Biological Process: apoptosis; cell-cell adhesion; positive regulation of proteolysis; vascular endothelial growth factor receptor signaling pathway

Research Articles on CYFIP2

Similar Products

Product Notes

The CYFIP2 cyfip2 (Catalog #AAA1272793) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccacgc acgtcaccct ggaagatgcc ctgtccaacg tggacctgct tgaagagctt cccctccccg accagcagcc atgcatcgag cctccacctt cctccatcat gtaccaggct aactttgaca caaactttga ggacaggaat gcatttgtca cgggcattgc aaggtacatt gagcaggcta cagtccactc cagcatgaat gagatgctgg aggaaggaca tgagtatgcg gtcatgctgt acacctggcg cagctgttcc cgggccattc cccaggtgaa atgcaacgag cagcccaacc gagtagagat ctatgagaag acagtagagg tgctggagcc ggaggtcacc aagctcatga agttcatgta ttttcagcgc aaggccatcg agcggttctg cagcgaggtg aagcggctgt gccatgccga gcgcaggaag gactttgtct ctgaggccta cctcctgacc cttggcaagt tcatcaacat gtttgctgtc ctggatgagc taaagaacat gaagtgcagc gtcaagaatg accactctgc ctacaagagg gcagcacagt tcctgcggaa gatggcagat ccccagtcta tccaggagtc gcagaacctt tccatgttcc tggccaacca caacaggatc acccagtgtc tccaccagca acttgaagtg atcccaggct atgaggagct gctggctgac attgtcaaca tctgtgtgga ttactacgag aacaagatgt acctgactcc cagtgagaaa catatgctcc tcaaggtgat gggctttggc ctctacctaa tggatggaaa tgtcagtaac atttacaaac tggatgccaa gaagagaatt aatcttagca aaattgataa attctttaag cagctgcagg tggtgcccct tttcggcgac atgcagatag agctggccag atacattaag accagtgctc actatgaaga gaacaagtcc aagtggacgt gcacccagag cagcatcagc ccccagtaca atatctgcga gcagatggtt cagatccggg atgaccacat ccgcttcatc tccgagctcg ctcgctacag caacagtgag gtggtgacgg gctcagggct ggacagccag aagtcagacg aggagtatcg cgagctcttc gacctagccc tgcggggtct gcagcttcta tccaagtgga gcgcccacgt catggaggtg tactcttgga agctggttca tcccacagac aagttctgca acaaggactg tcctggcacc gcggaggaat atgagagagc cacacgctac aattacacca gtgaggaaaa atttgccttc gttgaggtga tcgccatgat caaaggcctg caggtgctca tgggcaggat ggagagcgtc ttcaaccagg ccatcaggaa caccatctac gcggcattgc aggacttcgc ccaggtgacg ctgcgtgagc ccctgcggca ggcggtacgg aagaagaaga atgtcctcat cagcgtccta caggcaattc gaaagaccat ctgtgactgg gagggagggc gagagccccc taatgaccca tgcttgagag gggagaagga ccccaaaggt ggatttgata tcaaggtgcc ccggcgtgct gtggggccat ccagcacaca gctgtacatg gtgcggacca tgcttgaatc actcattgca gacaaaagcg gctccaagaa gaccctgagg agcagcctgg atggacccat tgtcctcgcc atagaggact ttcacaaaca gtccttcttc ttcacacatc tgctcaacat cagtgaagcc ctgcagcagt gttgtgacct ctcccagctc tggttccgag aattcttcct ggagttaacc atgggccgac gaatccagtt ccccatcgag atgtccatgc cctggattct aacggaccat atcctggaaa ccaaagaacc ttccatgatg gagtatgtcc tctaccctct ggatctgtac aacgacagcg cctactatgc tctgaccaag tttaaaaagc agttcctgta cgatgagata gaagctgagg tgaacctgtg ttttgatcag tttgtctaca agctggcaga ccagatcttt gcttactaca aagccatggc tggcagtgtc ctgttggata aacgttttcg agctgagtgt aagaattatg gcgtcatcat tccgtatcca ccgtccaatc gctatgaaac actgctgaag cagagacacg tccagctgtt gggtagatca attgacttga acagactcat tacccagcgc acctctgccg ccatgtataa atccttggac caagctatca gccgctttga gagtgaggac ctgacctcca ttgtggagct ggagtggctg ctggagatta accggctcac gcatcggctg ctctgtaagc atatgacgct ggacagcttc gatgccatgt tccgagaggc caatcacaat gtgtccgccc cctatggccg tatcaccctg catgtcttct gggaactgaa ctttgacttt ctccccaact actgctacaa tgggtccact aaccgttttg tgcggactgc cattcctttc acccaagaac cacaacgaga caaacctgcc aacgtccagc cttattacct ctatggatcc aagcctctca acattgccta cagccacatc tacagctcct acaggaattt cgtggggcca cctcatttca agactatctg cagactcctg ggttatcagg gcatcgctgt ggtcatggag gaactgctaa agattgtgaa gagcttgctc caaggaacca ttctccagta tgtgaaaaca ctgatagagg tgatgcccaa gatatgccgc ttgccccgac atgagtatgg ctccccaggg atcctggagt tcttccacca ccagctgaag gacatcattg agtacgcaga gctcaaaaca gacgtgttcc agagcctgag ggaagtgggc aatgccatcc tcttctgcct cctcatagag caagctctgt ctcaggagga ggtctgcgat ttgctccatg ccgcaccctt ccaaaacatc ttgcctagag tctacatcaa agagggggag cgcctggagg tccggatgaa acgtctggaa gccaagtatg ccccgctcca cctggtccct ctgatcgagc ggctggggac ccctcagcaa atcgccattg ctcgcgaggg tgacctcctg accaaggagc ggctgtgctg tggcctgtcc atgttcgagg tcatcctgac ccgcattcgg agctacctgc aggaccccat ctggcggggc ccaccgccca ccaatggcgt catgcacgtc gatgagtgtg tggagttcca ccggctgtgg agcgccatgc agttcgtgta ctgcatccct gtgggaacca acgagttcac agctgagcag tgtttcggcg atggcttgaa ctgggctggt tgctccatca ttgtcctgct gggccagcag cgtcgctttg acctgttcga cttctgttac cacctgctaa aagtgcagag gcaggacggg aaggatgaaa tcattaagaa tgtgcccctg aagaagatgg ccgaccggat caggaagtat cagatcttga acaatgaggt ttttgccatc ctgaacaaat acatgaagtc cgtggagaca gacagttcca ctgtggagca tgtgcgctgc ttccagccac ccatccacca gtccttggcc accacttgct aa. It is sometimes possible for the material contained within the vial of "CYFIP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.