Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CYBB cdna clone

CYBB cDNA Clone

Gene Names
CYBB; CGD; NOX2; IMD34; AMCBX2; GP91-1; GP91PHOX; p91-PHOX; GP91-PHOX
Synonyms
CYBB; CYBB cDNA Clone; CYBB cdna clone
Ordering
For Research Use Only!
Sequence
atggggaactgggctgtgaatgaggggctctccatttttgtcattctggtttggctggggttgaacgtcttcctctttgtctggtattaccgggtttatgatattccacctaagttcttttacacaagaaaacttcttgggtcagcactggcactggccagggcccctgcagcctgcctgaatttcaactgcatgctgattctcttgccagtctgtcgaaatctgctgtccttcctcaggggttccagtgcgtgctgctcaacaagagttcgaagacaactggacaggaatctcacctttcataaaatggtggcatggatgattgcacttcactctgcgattcacaccattgcacatctatttaatgtggaatggtgtgtgaatgcccgagtcaataattctgatccttattcagtagcactctctgaacttggagacaggcaaaatgaaagttatctcaattttgctcgaaagagaataaagaaccctgaaggaggcctgtacctggctgtgaccctgttggcaggcatcactggagttgtcatcacgctgtgcctcatattaattatcacttcctccaccaaaaccatccggaggtcttactttgaagtcttttggtacacacatcatctctttgtgatcttcttcattggccttgccatccatggagctgaacgaattgtacgtgggcagaccgcagagagtttggctgtgcataatataacagtttgtgaacaaaaaatctcagaatggggaaaaataaaggaatgcccaatccctcagtttgctggaaaccctcctatgacttggaaatggatagtgggtcccatgtttctgtatctctgtgagaggttggtgcggttttggcgatctcaacagaaggtggtcatcaccaaggtggtcactcaccctttcaaaaccatcgagctacagatgaagaagaaggggttcaaaatggaagtgggacaatacatttttgtcaagtgcccaaaggtgtccaagctggagtggcacccttttacactgacatccgcccctgaggaagacttctttagtatccatatccgcatcgttggggactggacagaggggctgttcaatgcttgtggctgtgataagcaggagtttcaagatgcgtggaaactacctaagatagcggttgatgggccctttggcactgccagtgaagatgtgttcagctatgaggtggtgatgttagtgggagcagggattggggtcacacccttcgcatccattctcaagtcagtctggtacaaatattgcaataacgccaccaatctgaagctcaaaaagatctacttctactggctgtgccgggacacacatgcctttgagtggtttgcagatctgctgcaactgctggagagccagatgcaggaaaggaacaatgccggcttcctcagctacaacatctacctcactggctgggatgagtctcaggccaatcactttgctgtgcaccatgatgaggagaaagatgtgatcacaggcctgaaacaaaagactttgtatggacggcccaactgggataatgaattcaagacaattgcaagtcaacaccctaataccagaataggagttttcctctgtggacctgaagccttggctgaaaccctgagtaaacaaagcatctccaactctgagtctggccctcggggagtgcatttcattttcaacaaggaaaacttctaa
Sequence Length
1713
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,336 Da
NCBI Official Full Name
Homo sapiens cytochrome b-245, beta polypeptide, mRNA
NCBI Official Synonym Full Names
cytochrome b-245 beta chain
NCBI Official Symbol
CYBB
NCBI Official Synonym Symbols
CGD; NOX2; IMD34; AMCBX2; GP91-1; GP91PHOX; p91-PHOX; GP91-PHOX
NCBI Protein Information
cytochrome b-245 heavy chain
UniProt Protein Name
Cytochrome b-245 heavy chain
Protein Family
UniProt Gene Name
CYBB
UniProt Synonym Gene Names
NOX2; Cytochrome b558 subunit beta
UniProt Entry Name
CY24B_HUMAN

NCBI Description

Cytochrome b (-245) is composed of cytochrome b alpha (CYBA) and beta (CYBB) chain. It has been proposed as a primary component of the microbicidal oxidase system of phagocytes. CYBB deficiency is one of five described biochemical defects associated with chronic granulomatous disease (CGD). In this disorder, there is decreased activity of phagocyte NADPH oxidase; neutrophils are able to phagocytize bacteria but cannot kill them in the phagocytic vacuoles. The cause of the killing defect is an inability to increase the cell's respiration and consequent failure to deliver activated oxygen into the phagocytic vacuole. [provided by RefSeq, Jul 2008]

Uniprot Description

CYBB: Critical component of the membrane-bound oxidase of phagocytes that generates superoxide. It is the terminal component of a respiratory chain that transfers single electrons from cytoplasmic NADPH across the plasma membrane to molecular oxygen on the exterior. Also functions as a voltage-gated proton channel that mediates the H(+) currents of resting phagocytes. It participates in the regulation of cellular pH and is blocked by zinc. Defects in CYBB are a cause of granulomatous disease,chronic, X-linked (CGD). A disorder characterized by the inability of neutrophils and phagocytes to kill microbes that they have ingested. Patients suffer from life- threatening bacterial/fungal infections. Defects in CYBB are a cause of mycobacteriosis atypical X-linked type 2 (AMCBX2). A rare condition characterized by predisposition to illness caused by moderately virulent mycobacterial species, such as Bacillus Calmette-Guerin (BCG) vaccine and environmental non-tuberculous mycobacteria, and by the more virulent Mycobacterium tuberculosis. Other microorganisms rarely cause severe clinical disease in individuals with susceptibility to mycobacterial infections.

Protein type: Membrane protein, multi-pass; Oxidoreductase; Mitochondrial; Membrane protein, integral; EC 1.-.-.-

Chromosomal Location of Human Ortholog: Xp21.1

Cellular Component: endoplasmic reticulum membrane; integral to plasma membrane; NADPH oxidase complex; phagocytic vesicle membrane; plasma membrane

Molecular Function: electron carrier activity; FAD binding; heme binding; protein binding; protein heterodimerization activity; superoxide-generating NADPH oxidase activity

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; cell redox homeostasis; inflammatory response; innate immune response; respiratory burst; response to reactive oxygen species; superoxide metabolic process; superoxide release; vascular endothelial growth factor receptor signaling pathway

Disease: Granulomatous Disease, Chronic, X-linked; Immunodeficiency 34

Research Articles on CYBB

Similar Products

Product Notes

The CYBB cybb (Catalog #AAA1277305) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaact gggctgtgaa tgaggggctc tccatttttg tcattctggt ttggctgggg ttgaacgtct tcctctttgt ctggtattac cgggtttatg atattccacc taagttcttt tacacaagaa aacttcttgg gtcagcactg gcactggcca gggcccctgc agcctgcctg aatttcaact gcatgctgat tctcttgcca gtctgtcgaa atctgctgtc cttcctcagg ggttccagtg cgtgctgctc aacaagagtt cgaagacaac tggacaggaa tctcaccttt cataaaatgg tggcatggat gattgcactt cactctgcga ttcacaccat tgcacatcta tttaatgtgg aatggtgtgt gaatgcccga gtcaataatt ctgatcctta ttcagtagca ctctctgaac ttggagacag gcaaaatgaa agttatctca attttgctcg aaagagaata aagaaccctg aaggaggcct gtacctggct gtgaccctgt tggcaggcat cactggagtt gtcatcacgc tgtgcctcat attaattatc acttcctcca ccaaaaccat ccggaggtct tactttgaag tcttttggta cacacatcat ctctttgtga tcttcttcat tggccttgcc atccatggag ctgaacgaat tgtacgtggg cagaccgcag agagtttggc tgtgcataat ataacagttt gtgaacaaaa aatctcagaa tggggaaaaa taaaggaatg cccaatccct cagtttgctg gaaaccctcc tatgacttgg aaatggatag tgggtcccat gtttctgtat ctctgtgaga ggttggtgcg gttttggcga tctcaacaga aggtggtcat caccaaggtg gtcactcacc ctttcaaaac catcgagcta cagatgaaga agaaggggtt caaaatggaa gtgggacaat acatttttgt caagtgccca aaggtgtcca agctggagtg gcaccctttt acactgacat ccgcccctga ggaagacttc tttagtatcc atatccgcat cgttggggac tggacagagg ggctgttcaa tgcttgtggc tgtgataagc aggagtttca agatgcgtgg aaactaccta agatagcggt tgatgggccc tttggcactg ccagtgaaga tgtgttcagc tatgaggtgg tgatgttagt gggagcaggg attggggtca cacccttcgc atccattctc aagtcagtct ggtacaaata ttgcaataac gccaccaatc tgaagctcaa aaagatctac ttctactggc tgtgccggga cacacatgcc tttgagtggt ttgcagatct gctgcaactg ctggagagcc agatgcagga aaggaacaat gccggcttcc tcagctacaa catctacctc actggctggg atgagtctca ggccaatcac tttgctgtgc accatgatga ggagaaagat gtgatcacag gcctgaaaca aaagactttg tatggacggc ccaactggga taatgaattc aagacaattg caagtcaaca ccctaatacc agaataggag ttttcctctg tggacctgaa gccttggctg aaaccctgag taaacaaagc atctccaact ctgagtctgg ccctcgggga gtgcatttca ttttcaacaa ggaaaacttc taa. It is sometimes possible for the material contained within the vial of "CYBB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.