Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CYBA cdna clone

CYBA cDNA Clone

Gene Names
CYBA; p22-PHOX
Synonyms
CYBA; CYBA cDNA Clone; CYBA cdna clone
Ordering
For Research Use Only!
Sequence
atggggcagatcgagtgggccatgtgggccaacgagcaggcgctggcgtccggcctgagtgagtgcacgtcagggacggtggaggctgcagcctggaggggtgtcccaagaccccagccgggacctcgggctacttacagggtggggaagtggggcgccaggcgggccaggccgggccggggtcaggccaggagggtgcggggaacgggggcgggaccctcaggccgcgggctggaaggaggagttctgagacccccagtaattcccttgcagaccctgcggagcgcggcgcccctcccccattcccttctctcggtcccccgactccgcgaaggaggaagttgcagcgcaggggaagaggcggttcagccccggtggtttccggggtcaccgccccgaagcccccgagtgggggctccggcctgggcatcgggagaagctcccctgcccctcggtagccagctggcctggaggtcgctctccctgggcttggggtggggaatgggctcatgccctggggctcagcccttctcatctggagtctgcgctggaggcggtctgagatttcacaaggcgccgaaaccacccagtgacggccctgcccagcccagctgcacaggcactttgctcttggggtgggatggcacagcccccagtcaccctcctgtgcatttgctcagaggttctggtgagggcagcggactccatttggaaatggaccctctcgggaccagggccagggagtgtctggcccagcacgggtga
Sequence Length
765
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,013 Da
NCBI Official Full Name
Homo sapiens cytochrome b-245, alpha polypeptide, mRNA
NCBI Official Synonym Full Names
cytochrome b-245 alpha chain
NCBI Official Symbol
CYBA
NCBI Official Synonym Symbols
p22-PHOX
NCBI Protein Information
cytochrome b-245 light chain
UniProt Protein Name
Cytochrome b-245 light chain
Protein Family
UniProt Gene Name
CYBA
UniProt Synonym Gene Names
p22phox
UniProt Entry Name
CY24A_HUMAN

NCBI Description

Cytochrome b is comprised of a light chain (alpha) and a heavy chain (beta). This gene encodes the light, alpha subunit which has been proposed as a primary component of the microbicidal oxidase system of phagocytes. Mutations in this gene are associated with autosomal recessive chronic granulomatous disease (CGD), that is characterized by the failure of activated phagocytes to generate superoxide, which is important for the microbicidal activity of these cells. [provided by RefSeq, Jul 2008]

Uniprot Description

CYBA: Critical component of the membrane-bound oxidase of phagocytes that generates superoxide. Associates with NOX3 to form a functional NADPH oxidase constitutively generating superoxide. Defects in CYBA are a cause of chronic granulomatous disease autosomal recessive cytochrome-b-negative (ARCGD). Chronic granulomatous disease is a genetically heterogeneous disorder characterized by the inability of neutrophils and phagocytes to kill microbes that they have ingested. Patients suffer from life-threatening bacterial/fungal infections. Belongs to the p22phox family.

Protein type: Oxidoreductase; Membrane protein, integral; EC 1.-.-.-

Chromosomal Location of Human Ortholog: 16q24

Cellular Component: endoplasmic reticulum membrane; membrane; NADPH oxidase complex; phagocytic vesicle membrane; plasma membrane; secretory granule

Molecular Function: electron carrier activity; protein binding; protein heterodimerization activity; SH3 domain binding; superoxide-generating NADPH oxidase activity

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; cell redox homeostasis; cytochrome complex assembly; hydrogen peroxide biosynthetic process; inflammatory response; innate immune response; positive regulation of interleukin-6 production; positive regulation of phagocytosis; positive regulation of toll-like receptor 2 signaling pathway; positive regulation of tumor necrosis factor production; respiratory burst; response to reactive oxygen species; smooth muscle hypertrophy; superoxide metabolic process; superoxide release; vascular endothelial growth factor receptor signaling pathway

Disease: Granulomatous Disease, Chronic, Autosomal Recessive, Cytochrome B-negative

Research Articles on CYBA

Similar Products

Product Notes

The CYBA cyba (Catalog #AAA1271415) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggcaga tcgagtgggc catgtgggcc aacgagcagg cgctggcgtc cggcctgagt gagtgcacgt cagggacggt ggaggctgca gcctggaggg gtgtcccaag accccagccg ggacctcggg ctacttacag ggtggggaag tggggcgcca ggcgggccag gccgggccgg ggtcaggcca ggagggtgcg gggaacgggg gcgggaccct caggccgcgg gctggaagga ggagttctga gacccccagt aattcccttg cagaccctgc ggagcgcggc gcccctcccc cattcccttc tctcggtccc ccgactccgc gaaggaggaa gttgcagcgc aggggaagag gcggttcagc cccggtggtt tccggggtca ccgccccgaa gcccccgagt gggggctccg gcctgggcat cgggagaagc tcccctgccc ctcggtagcc agctggcctg gaggtcgctc tccctgggct tggggtgggg aatgggctca tgccctgggg ctcagccctt ctcatctgga gtctgcgctg gaggcggtct gagatttcac aaggcgccga aaccacccag tgacggccct gcccagccca gctgcacagg cactttgctc ttggggtggg atggcacagc ccccagtcac cctcctgtgc atttgctcag aggttctggt gagggcagcg gactccattt ggaaatggac cctctcggga ccagggccag ggagtgtctg gcccagcacg ggtga. It is sometimes possible for the material contained within the vial of "CYBA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.