Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CYB561D2 cdna clone

CYB561D2 cDNA Clone

Gene Names
CYB561D2; 101F6; TSP10; XXcos-LUCA11.4
Synonyms
CYB561D2; CYB561D2 cDNA Clone; CYB561D2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccctttctgcggagaccgagtcacacatctaccgagctctgcgtactgcttctggcgctgccgcccaccttgtggccctgggctttaccatctttgtggctgtgcttgccaggcctggctccagcctgttctcctggcacccggtgcttatgtctttggctttctccttcctgatgaccgaggcactactggtgttttctcctgagagttcgctgctgcactccctctcacggaaaggccgagcacgctgccactgggtgctgcagctgctggccctgctgtgtgcactgctgggcctcggccttgtcatcctccacaaagagcagcttggcaaagcccacctggttacgcggcatgggcaggcagggctgctggctgtgctgtgggcagggctgcagtgctcaggtggggtggggctgctctaccccaagctgctgccccgatggcccctggcgaagctcaagctataccatgctacttctgggctggtgggctacctgctgggtagtgccagcctcttgctgggcatgtgctcactctggttcactgcctctgtcactggtgcagcctggtacctggctgtattatgccctgtcctcaccagcttggtcattatgaaccaggtgagcaatgcctacctataccgcaagaggatccaaccatga
Sequence Length
669
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,974 Da
NCBI Official Full Name
Homo sapiens cytochrome b-561 domain containing 2, mRNA
NCBI Official Synonym Full Names
cytochrome b561 family member D2
NCBI Official Symbol
CYB561D2
NCBI Official Synonym Symbols
101F6; TSP10; XXcos-LUCA11.4
NCBI Protein Information
cytochrome b561 domain-containing protein 2
UniProt Protein Name
Cytochrome b561 domain-containing protein 2
UniProt Gene Name
CYB561D2
UniProt Synonym Gene Names
101F6
UniProt Entry Name
C56D2_HUMAN

Uniprot Description

CYB561D2:

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 3p21.3

Research Articles on CYB561D2

Similar Products

Product Notes

The CYB561D2 cyb561d2 (Catalog #AAA1272319) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccttt ctgcggagac cgagtcacac atctaccgag ctctgcgtac tgcttctggc gctgccgccc accttgtggc cctgggcttt accatctttg tggctgtgct tgccaggcct ggctccagcc tgttctcctg gcacccggtg cttatgtctt tggctttctc cttcctgatg accgaggcac tactggtgtt ttctcctgag agttcgctgc tgcactccct ctcacggaaa ggccgagcac gctgccactg ggtgctgcag ctgctggccc tgctgtgtgc actgctgggc ctcggccttg tcatcctcca caaagagcag cttggcaaag cccacctggt tacgcggcat gggcaggcag ggctgctggc tgtgctgtgg gcagggctgc agtgctcagg tggggtgggg ctgctctacc ccaagctgct gccccgatgg cccctggcga agctcaagct ataccatgct acttctgggc tggtgggcta cctgctgggt agtgccagcc tcttgctggg catgtgctca ctctggttca ctgcctctgt cactggtgca gcctggtacc tggctgtatt atgccctgtc ctcaccagct tggtcattat gaaccaggtg agcaatgcct acctataccg caagaggatc caaccatga. It is sometimes possible for the material contained within the vial of "CYB561D2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.