Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CXXC5 cdna clone

CXXC5 cDNA Clone

Gene Names
CXXC5; CF5; WID; RINF; HSPC195
Synonyms
CXXC5; CXXC5 cDNA Clone; CXXC5 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgggcggagagtctgctgacaaggccactgcggctgcagccgctgcctccctgttggccaatgggcatgacctggcggcggccatggcggtggacaaaagcaaccctacctcaaagcacaaaagtggtgctgtggccagcctgctgagcaaggcagagcgggccacggagctggcagccgagggacagctgacgctgcagcagtttgcgcagtccacagagatgctgaagcgcgtggtgcaggagcatctcccgctgatgagcgaggcgggtgctggcctgcctgacatggaggctgtggcaggtgccgaagccctcaatggccagtccgacttcccctacctgggcgctttccccatcaacccaggcctcttcattatgaccccggcaggtgtgttcctggccgagagcgcgctgcacatggcgggcctggctgagtaccccatgcagggagagctggcctctgccatcagctccggcaagaagaagcggaaacgctgcggcatgtgcgcgccctgccggcggcgcatcaactgcgagcagtgcagcagttgtaggaatcgaaagactggccatcagatttgcaaattcagaaaatgtgaggaactcaaaaagaagccttccgctgctctggagaaggtgatgcttccgacgggagccgccttccggtggtttcagtga
Sequence Length
684
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,072 Da
NCBI Official Full Name
Homo sapiens CXXC finger 5, mRNA
NCBI Official Synonym Full Names
CXXC finger protein 5
NCBI Official Symbol
CXXC5
NCBI Official Synonym Symbols
CF5; WID; RINF; HSPC195
NCBI Protein Information
CXXC-type zinc finger protein 5
UniProt Protein Name
CXXC-type zinc finger protein 5
UniProt Gene Name
CXXC5
UniProt Synonym Gene Names
CF5; RINF
UniProt Entry Name
CXXC5_HUMAN

NCBI Description

The protein encoded by this gene is a retinoid-inducible nuclear protein containing a CXXC-type zinc finger motif. The encoded protein is involved in myelopoiesis, is required for DNA damage-induced p53 activation, regulates the differentiation of C2C12 myoblasts into myocytes, and negatively regulates cutaneous wound healing. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2015]

Uniprot Description

CXXC5: May indirectly participate in activation of the NF- kappa-B and MAPK pathways. Acts as a mediator of BMP4-mediated modulation of canonical Wnt signaling activity in neural stem cells. Required for DNA damage-induced ATM phosphorylation, p53 activation and cell cycle arrest. Involved in myelopoiesis. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 5q31.2

Cellular Component: cytoplasm; nucleoplasm

Molecular Function: protein binding; sequence-specific DNA binding; signal transducer activity; transcription factor binding

Biological Process: negative regulation of transcription from RNA polymerase II promoter; positive regulation of I-kappaB kinase/NF-kappaB cascade

Research Articles on CXXC5

Similar Products

Product Notes

The CXXC5 cxxc5 (Catalog #AAA1275507) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgggcg gagagtctgc tgacaaggcc actgcggctg cagccgctgc ctccctgttg gccaatgggc atgacctggc ggcggccatg gcggtggaca aaagcaaccc tacctcaaag cacaaaagtg gtgctgtggc cagcctgctg agcaaggcag agcgggccac ggagctggca gccgagggac agctgacgct gcagcagttt gcgcagtcca cagagatgct gaagcgcgtg gtgcaggagc atctcccgct gatgagcgag gcgggtgctg gcctgcctga catggaggct gtggcaggtg ccgaagccct caatggccag tccgacttcc cctacctggg cgctttcccc atcaacccag gcctcttcat tatgaccccg gcaggtgtgt tcctggccga gagcgcgctg cacatggcgg gcctggctga gtaccccatg cagggagagc tggcctctgc catcagctcc ggcaagaaga agcggaaacg ctgcggcatg tgcgcgccct gccggcggcg catcaactgc gagcagtgca gcagttgtag gaatcgaaag actggccatc agatttgcaa attcagaaaa tgtgaggaac tcaaaaagaa gccttccgct gctctggaga aggtgatgct tccgacggga gccgccttcc ggtggtttca gtga. It is sometimes possible for the material contained within the vial of "CXXC5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.