Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CXCL6 cdna clone

CXCL6 cDNA Clone

Gene Names
CXCL6; GCP2; CKA-3; GCP-2; SCYB6
Synonyms
CXCL6; CXCL6 cDNA Clone; CXCL6 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcctcccgtccagccgcgcggcccgtgtcccgggtccttcgggctccttgtgcgcgctgctcgcgctgctgctcctgctgacgccgccggggcccctcgccagcgctggtcctgtctctgctgtgctgacagagctgcgttgcacttgtttacgcgttacgctgagagtaaaccccaaaacgattggtaaactgcaggtgttccccgcaggcccgcagtgctccaaggtggaagtggtagcctccctgaagaacgggaagcaagtttgtctggacccggaagccccttttctaaagaaagtcatccagaaaattttggacagtggaaacaagaaaaactga
Sequence Length
345
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,897 Da
NCBI Official Full Name
Homo sapiens chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2), mRNA
NCBI Official Synonym Full Names
C-X-C motif chemokine ligand 6
NCBI Official Symbol
CXCL6
NCBI Official Synonym Symbols
GCP2; CKA-3; GCP-2; SCYB6
NCBI Protein Information
C-X-C motif chemokine 6
UniProt Protein Name
C-X-C motif chemokine 6
Protein Family
UniProt Gene Name
CXCL6
UniProt Synonym Gene Names
GCP2; SCYB6; CKA-3; GCP-2
UniProt Entry Name
CXCL6_HUMAN

Uniprot Description

CXCL6: Chemotactic for neutrophil granulocytes. Belongs to the intercrine alpha (chemokine CxC) family.

Protein type: Secreted; Secreted, signal peptide; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 4q13.3

Cellular Component: extracellular region; extracellular space

Molecular Function: CXCR chemokine receptor binding

Biological Process: cell-cell signaling; chemotaxis; G-protein coupled receptor protein signaling pathway; immune response; inflammatory response; neutrophil mediated immunity; positive regulation of leukocyte chemotaxis; regulation of cell proliferation; response to lipopolysaccharide; signal transduction

Research Articles on CXCL6

Similar Products

Product Notes

The CXCL6 cxcl6 (Catalog #AAA1275321) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcctcc cgtccagccg cgcggcccgt gtcccgggtc cttcgggctc cttgtgcgcg ctgctcgcgc tgctgctcct gctgacgccg ccggggcccc tcgccagcgc tggtcctgtc tctgctgtgc tgacagagct gcgttgcact tgtttacgcg ttacgctgag agtaaacccc aaaacgattg gtaaactgca ggtgttcccc gcaggcccgc agtgctccaa ggtggaagtg gtagcctccc tgaagaacgg gaagcaagtt tgtctggacc cggaagcccc ttttctaaag aaagtcatcc agaaaatttt ggacagtgga aacaagaaaa actga. It is sometimes possible for the material contained within the vial of "CXCL6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.