Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CXCL5 cdna clone

CXCL5 cDNA Clone

Gene Names
CXCL5; SCYB5; ENA-78
Synonyms
CXCL5; CXCL5 cDNA Clone; CXCL5 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcctcctgtccagccgcgcggcccgtgtccccggtccttcgagctccttgtgcgcgctgttggtgctgctgctgctgctgacgcagccagggcccatcgccagcgctggtcctgccgctgctgtgttgagagagctgcgttgcgtttgtttacagaccacgcaaggagttcatcccaaaatgatcagtaatctgcaagtgttcgccataggcccacagtgctccaaggtggaagtggtagcctccctgaagaacgggaaggaaatttgtcttgatccagaagccccttttctaaagaaagtcatccagaaaattttggacggtggaaacaaggaaaactga
Sequence Length
345
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,972 Da
NCBI Official Full Name
Homo sapiens chemokine (C-X-C motif) ligand 5, mRNA
NCBI Official Synonym Full Names
C-X-C motif chemokine ligand 5
NCBI Official Symbol
CXCL5
NCBI Official Synonym Symbols
SCYB5; ENA-78
NCBI Protein Information
C-X-C motif chemokine 5
UniProt Protein Name
C-X-C motif chemokine 5
Protein Family
UniProt Gene Name
CXCL5
UniProt Synonym Gene Names
ENA78; SCYB5
UniProt Entry Name
CXCL5_HUMAN

NCBI Description

This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils, to promote angiogenesis and to remodel connective tissues. This protein is thought to play a role in cancer cell proliferation, migration, and invasion. [provided by RefSeq, May 2013]

Uniprot Description

CXCL5: Involved in neutrophil activation. In vitro, ENA-78(8- 78) and ENA-78(9-78) show a threefold higher chemotactic activity for neutrophil granulocytes. Belongs to the intercrine alpha (chemokine CxC) family.

Protein type: Motility/polarity/chemotaxis; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 4q13.3

Cellular Component: extracellular region; extracellular space

Molecular Function: CXCR chemokine receptor binding

Biological Process: cell-cell signaling; chemotaxis; G-protein coupled receptor protein signaling pathway; immune response; inflammatory response; neutrophil mediated immunity; positive regulation of cell proliferation; positive regulation of leukocyte chemotaxis; response to lipopolysaccharide; signal transduction

Research Articles on CXCL5

Similar Products

Product Notes

The CXCL5 cxcl5 (Catalog #AAA1275028) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcctcc tgtccagccg cgcggcccgt gtccccggtc cttcgagctc cttgtgcgcg ctgttggtgc tgctgctgct gctgacgcag ccagggccca tcgccagcgc tggtcctgcc gctgctgtgt tgagagagct gcgttgcgtt tgtttacaga ccacgcaagg agttcatccc aaaatgatca gtaatctgca agtgttcgcc ataggcccac agtgctccaa ggtggaagtg gtagcctccc tgaagaacgg gaaggaaatt tgtcttgatc cagaagcccc ttttctaaag aaagtcatcc agaaaatttt ggacggtgga aacaaggaaa actga. It is sometimes possible for the material contained within the vial of "CXCL5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.