Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CXCL14 cdna clone

CXCL14 cDNA Clone

Gene Names
CXCL14; KEC; KS1; BMAC; BRAK; NJAC; MIP2G; MIP-2g; SCYB14
Synonyms
CXCL14; CXCL14 cDNA Clone; CXCL14 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccctgctcccacgccgcgcccctccggtcagcatgaggctcctggcggccgcgctgctcctgctgctgctggcgctgtacaccgcgcgtgtggacgggtccaaatgcaagtgctcccggaagggacccaagatccgctacagcgacgtgaagaagctggaaatgaagccaaagtacccgcactgcgaggagaagatggttatcatcaccaccaagagcgtgtccaggtaccgaggtcaggagcactgcctgcaccccaagctgcagagcaccaagcgcttcatcaagtggtacaacgcctggaacgagaagcgcagggtctacgaagaatag
Sequence Length
336
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,078 Da
NCBI Official Full Name
Homo sapiens chemokine (C-X-C motif) ligand 14, mRNA
NCBI Official Synonym Full Names
C-X-C motif chemokine ligand 14
NCBI Official Symbol
CXCL14
NCBI Official Synonym Symbols
KEC; KS1; BMAC; BRAK; NJAC; MIP2G; MIP-2g; SCYB14
NCBI Protein Information
C-X-C motif chemokine 14
UniProt Protein Name
C-X-C motif chemokine 14
Protein Family
UniProt Gene Name
CXCL14
UniProt Synonym Gene Names
MIP2G; NJAC; SCYB14
UniProt Entry Name
CXL14_HUMAN

NCBI Description

This antimicrobial gene belongs to the cytokine gene family which encode secreted proteins involved in immunoregulatory and inflammatory processes. The protein encoded by this gene is structurally related to the CXC (Cys-X-Cys) subfamily of cytokines. Members of this subfamily are characterized by two cysteines separated by a single amino acid. This cytokine displays chemotactic activity for monocytes but not for lymphocytes, dendritic cells, neutrophils or macrophages. It has been implicated that this cytokine is involved in the homeostasis of monocyte-derived macrophages rather than in inflammation. [provided by RefSeq, Sep 2014]

Uniprot Description

CXCL14: Potent chemoattractant for neutrophils, and weaker for dendritic cells. Not chemotactic for T-cells, B-cells, monocytes, natural killer cells or granulocytes. Does not inhibit proliferation of myeloid progenitors in colony formation assays. Belongs to the intercrine alpha (chemokine CxC) family.

Protein type: Secreted, signal peptide; Motility/polarity/chemotaxis; Chemokine; Secreted

Chromosomal Location of Human Ortholog: 5q31

Cellular Component: Golgi apparatus

Molecular Function: protein binding

Biological Process: cell-cell signaling; chemotaxis; signal transduction

Research Articles on CXCL14

Similar Products

Product Notes

The CXCL14 cxcl14 (Catalog #AAA1271026) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccctgc tcccacgccg cgcccctccg gtcagcatga ggctcctggc ggccgcgctg ctcctgctgc tgctggcgct gtacaccgcg cgtgtggacg ggtccaaatg caagtgctcc cggaagggac ccaagatccg ctacagcgac gtgaagaagc tggaaatgaa gccaaagtac ccgcactgcg aggagaagat ggttatcatc accaccaaga gcgtgtccag gtaccgaggt caggagcact gcctgcaccc caagctgcag agcaccaagc gcttcatcaa gtggtacaac gcctggaacg agaagcgcag ggtctacgaa gaatag. It is sometimes possible for the material contained within the vial of "CXCL14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.