Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CXCL10 cdna clone

CXCL10 cDNA Clone

Gene Names
CXCL10; C7; IFI10; INP10; IP-10; crg-2; mob-1; SCYB10; gIP-10
Synonyms
CXCL10; CXCL10 cDNA Clone; CXCL10 cdna clone
Ordering
For Research Use Only!
Sequence
atgaatcaaactgccattctgatttgctgccttatctttctgactctaagtggcattcaaggagtacctctctctagaactgtacgctgtacctgcatcagcattagtaatcaacctgttaatccaaggtctttagaaaaacttgaaattattcctgcaagccaattttgtccacgtgttgagatcattgctacaatgaaaaagaagggtgagaagagatgtctgaatccagaatcgaaggccatcaagaatttactgaaagcagttagcaaggaaaggtctaaaagatctccttaa
Sequence Length
297
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,881 Da
NCBI Official Full Name
Homo sapiens chemokine (C-X-C motif) ligand 10, mRNA
NCBI Official Synonym Full Names
C-X-C motif chemokine ligand 10
NCBI Official Symbol
CXCL10
NCBI Official Synonym Symbols
C7; IFI10; INP10; IP-10; crg-2; mob-1; SCYB10; gIP-10
NCBI Protein Information
C-X-C motif chemokine 10
UniProt Protein Name
C-X-C motif chemokine 10
Protein Family
UniProt Gene Name
CXCL10
UniProt Synonym Gene Names
INP10; SCYB10; Gamma-IP10; IP-10
UniProt Entry Name
CXL10_HUMAN

NCBI Description

This antimicrobial gene encodes a chemokine of the CXC subfamily and ligand for the receptor CXCR3. Binding of this protein to CXCR3 results in pleiotropic effects, including stimulation of monocytes, natural killer and T-cell migration, and modulation of adhesion molecule expression. [provided by RefSeq, Sep 2014]

Uniprot Description

CXCL10: Chemotactic for monocytes and T-lymphocytes. Binds to CXCR3. Belongs to the intercrine alpha (chemokine CxC) family.

Protein type: Motility/polarity/chemotaxis; Chemokine; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 4q21

Cellular Component: extracellular region; extracellular space

Molecular Function: cAMP-dependent protein kinase regulator activity; chemokine activity; CXCR3 chemokine receptor binding; heparin binding; protein binding; receptor binding

Biological Process: blood circulation; cell surface receptor linked signal transduction; cell-cell signaling; chemotaxis; endothelial cell activation; G-protein coupled receptor protein signaling pathway; immune response; muscle development; positive regulation of cAMP metabolic process; positive regulation of release of sequestered calcium ion into cytosol; positive regulation of transcription from RNA polymerase II promoter; regulation of cell proliferation; signal transduction

Research Articles on CXCL10

Similar Products

Product Notes

The CXCL10 cxcl10 (Catalog #AAA1274380) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatcaaa ctgccattct gatttgctgc cttatctttc tgactctaag tggcattcaa ggagtacctc tctctagaac tgtacgctgt acctgcatca gcattagtaa tcaacctgtt aatccaaggt ctttagaaaa acttgaaatt attcctgcaa gccaattttg tccacgtgtt gagatcattg ctacaatgaa aaagaagggt gagaagagat gtctgaatcc agaatcgaag gccatcaaga atttactgaa agcagttagc aaggaaaggt ctaaaagatc tccttaa. It is sometimes possible for the material contained within the vial of "CXCL10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.