CTRL cdna clone
CTRL cDNA Clone
Gene Names
CTRL; CTRL1
Synonyms
CTRL; CTRL cDNA Clone; CTRL cdna clone
Sequence
atgttgctgctcagcctgaccctaagcctggttctcctcggctcctcctggggctgcggcattcctgccatcaaaccggcactgagcttcagccagaggattgtcaacggggagaatgcagtgttgggctcctggccctggcaggtgtccctgcaggacagcagcggcttccacttctgcggtggttctctcatcagccagtcctgggtggtcactgctgcccactgcaatgtcagccctggccgccattttgttgtcctgggcgagtatgaccgatcatcaaacgcagagcccttgcaggttctgtccgtctctcgggccattacacaccctagctggaactctaccaccatgaacaatgacgtgacgctgctgaagctcgcctcgccagcccagtacacaacacgcatctcgccagtttgcctggcatcctcaaacgaggctctgactgaaggcctcacgtgtgtcaccaccggctggggtcgcctcagtggcgtgggcaatgtgacaccagcacatctgcagcaggtggctttgcccctggtcactgtgaatcagtgccggcagtactggggctcaagtatcactgactccatgatctgtgcaggtggcgcaggtgcctcctcgtgccagggtgactccggaggccctcttgtctgccagaagggaaacacatgggtgcttattggtattgtctcctggggcaccaaaaactgcaatgtgcgcgcacctgctgtgtatactcgagttagcaagttcagcacctggatcaaccaggtcatagcctacaactga
Sequence Length
795
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
28,002 Da
NCBI Official Full Name
Homo sapiens chymotrypsin-like, mRNA
NCBI Official Synonym Full Names
chymotrypsin like
NCBI Official Symbol
CTRL
NCBI Official Synonym Symbols
CTRL1
NCBI Protein Information
chymotrypsin-like protease CTRL-1
UniProt Protein Name
Chymotrypsin-like protease CTRL-1
Protein Family
UniProt Gene Name
CTRL
UniProt Synonym Gene Names
CTRL1
UniProt Entry Name
CTRL_HUMAN
Uniprot Description
CTRL: Belongs to the peptidase S1 family.
Protein type: EC 3.4.21.-; Protease
Chromosomal Location of Human Ortholog: 16q22.1
Cellular Component: extracellular space
Biological Process: digestion
Research Articles on CTRL
Similar Products
Product Notes
The CTRL ctrl (Catalog #AAA1266340) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgctgc tcagcctgac cctaagcctg gttctcctcg gctcctcctg gggctgcggc attcctgcca tcaaaccggc actgagcttc agccagagga ttgtcaacgg ggagaatgca gtgttgggct cctggccctg gcaggtgtcc ctgcaggaca gcagcggctt ccacttctgc ggtggttctc tcatcagcca gtcctgggtg gtcactgctg cccactgcaa tgtcagccct ggccgccatt ttgttgtcct gggcgagtat gaccgatcat caaacgcaga gcccttgcag gttctgtccg tctctcgggc cattacacac cctagctgga actctaccac catgaacaat gacgtgacgc tgctgaagct cgcctcgcca gcccagtaca caacacgcat ctcgccagtt tgcctggcat cctcaaacga ggctctgact gaaggcctca cgtgtgtcac caccggctgg ggtcgcctca gtggcgtggg caatgtgaca ccagcacatc tgcagcaggt ggctttgccc ctggtcactg tgaatcagtg ccggcagtac tggggctcaa gtatcactga ctccatgatc tgtgcaggtg gcgcaggtgc ctcctcgtgc cagggtgact ccggaggccc tcttgtctgc cagaagggaa acacatgggt gcttattggt attgtctcct ggggcaccaa aaactgcaat gtgcgcgcac ctgctgtgta tactcgagtt agcaagttca gcacctggat caaccaggtc atagcctaca actga. It is sometimes possible for the material contained within the vial of "CTRL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
