Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CTNNBIP1 cdna clone

CTNNBIP1 cDNA Clone

Gene Names
CTNNBIP1; ICAT
Synonyms
CTNNBIP1; CTNNBIP1 cDNA Clone; CTNNBIP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaccgcgagggagctcccgggaagagtccggaggagatgtacattcagcagaaggtccgagtgctgctcatgctgcggaagatgggatcaaacctgacagccagcgaggaggagttcctgcgcacctatgcaggggtggtcaacagccagctcagccagctgcctccgcactccatcgaccagggtgcagaggacgtggtgatggcgttttccaggtcggagacggaagaccggaggcagtag
Sequence Length
246
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,170 Da
NCBI Official Full Name
Homo sapiens catenin, beta interacting protein 1, mRNA
NCBI Official Synonym Full Names
catenin beta interacting protein 1
NCBI Official Symbol
CTNNBIP1
NCBI Official Synonym Symbols
ICAT
NCBI Protein Information
beta-catenin-interacting protein 1
UniProt Protein Name
Beta-catenin-interacting protein 1
UniProt Gene Name
CTNNBIP1
UniProt Synonym Gene Names
ICAT
UniProt Entry Name
CNBP1_HUMAN

NCBI Description

The protein encoded by this gene binds CTNNB1 and prevents interaction between CTNNB1 and TCF family members. The encoded protein is a negative regulator of the Wnt signaling pathway. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

CTNNBIP1: Prevents the interaction between CTNNB1 and TCF family members, and acts as negative regulator of the Wnt signaling pathway. Belongs to the CTNNBIP1 family.

Protein type: Inhibitor; Cell development/differentiation

Chromosomal Location of Human Ortholog: 1p36.22

Cellular Component: beta-catenin destruction complex; cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: beta-catenin binding; protein binding

Biological Process: anterior/posterior pattern formation; negative regulation of protein binding; negative regulation of transcription factor activity; negative regulation of Wnt receptor signaling pathway; positive regulation of monocyte differentiation; positive regulation of osteoblast differentiation; regulation of vascular permeability during acute inflammatory response; ureteric bud branching

Research Articles on CTNNBIP1

Similar Products

Product Notes

The CTNNBIP1 ctnnbip1 (Catalog #AAA1266858) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaccgcg agggagctcc cgggaagagt ccggaggaga tgtacattca gcagaaggtc cgagtgctgc tcatgctgcg gaagatggga tcaaacctga cagccagcga ggaggagttc ctgcgcacct atgcaggggt ggtcaacagc cagctcagcc agctgcctcc gcactccatc gaccagggtg cagaggacgt ggtgatggcg ttttccaggt cggagacgga agaccggagg cagtag. It is sometimes possible for the material contained within the vial of "CTNNBIP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.