Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CSTF3 cdna clone

CSTF3 cDNA Clone

Gene Names
CSTF3; CSTF-77
Synonyms
CSTF3; CSTF3 cDNA Clone; CSTF3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaggagacggagccacggagcaggcagctgagtatgtcccagagaaggtgaagaaagcggaaaagaaattagaagagaatccatatgaccttgatgcttggagcattctcattcgagaggcacagaatcaacctatagacaaagcacggaagacttatgaacgccttgttgcccagttccccagttctggcagattctggaaactgtacattgaagcagaggttactattttattttattttttcttatatcagtattgcagcattcactgtagtgatagaaaacaagttaggaacatagccaattag
Sequence Length
312
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
4,952 Da
NCBI Official Full Name
Homo sapiens cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa, mRNA
NCBI Official Synonym Full Names
cleavage stimulation factor subunit 3
NCBI Official Symbol
CSTF3
NCBI Official Synonym Symbols
CSTF-77
NCBI Protein Information
cleavage stimulation factor subunit 3
UniProt Protein Name
Cleavage stimulation factor subunit 3
UniProt Gene Name
CSTF3
UniProt Synonym Gene Names
CSTF 77 kDa subunit; CstF-77
UniProt Entry Name
CSTF3_HUMAN

NCBI Description

The protein encoded by this gene is one of three (including CSTF1 and CSTF2) cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in the polyadenylation and 3' end cleavage of pre-mRNAs. The encoded protein functions as a homodimer and interacts directly with both CSTF1 and CSTF2 in the CSTF complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

CstF-77: One of the multiple factors required for polyadenylation and 3'-end cleavage of mammalian pre-mRNAs. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding; RNA splicing

Chromosomal Location of Human Ortholog: 11p13

Cellular Component: nucleoplasm; nucleus

Molecular Function: mRNA binding; protein binding; RNA binding

Biological Process: mRNA 3'-end processing; mRNA cleavage; mRNA polyadenylation; nuclear mRNA splicing, via spliceosome; termination of RNA polymerase II transcription

Research Articles on CSTF3

Similar Products

Product Notes

The CSTF3 cstf3 (Catalog #AAA1269170) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaggag acggagccac ggagcaggca gctgagtatg tcccagagaa ggtgaagaaa gcggaaaaga aattagaaga gaatccatat gaccttgatg cttggagcat tctcattcga gaggcacaga atcaacctat agacaaagca cggaagactt atgaacgcct tgttgcccag ttccccagtt ctggcagatt ctggaaactg tacattgaag cagaggttac tattttattt tattttttct tatatcagta ttgcagcatt cactgtagtg atagaaaaca agttaggaac atagccaatt ag. It is sometimes possible for the material contained within the vial of "CSTF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.