Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CSTF2T cdna clone

CSTF2T cDNA Clone

Gene Names
CSTF2T; CstF-64T
Synonyms
CSTF2T; CSTF2T cDNA Clone; CSTF2T cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgagtttggcggtgagagacccggcaatggatcgatcactgcgttccgtgttcgtggggaacattccatatgaggcaactgaggagcagttaaaggacattttctcggaggttggttctgttgtcagtttccggctggtatacgatagagagacgggaaaacccaagggctatggcttctgcgaataccaagaccaggagaccgcgcttagtgccatgcggaacctcaatgggcgggagttcagtgggagagcgcttcgggtggacaatgctgccagtgaaaagaataaggaggagttaaagagcctcgggcctgcagcgcccattattgactcaccctatggggatcccatcgatccagaagatgcccctgaatcgattaccagagcagtagccagtctccccccggagcagatgtttgagctgatgaagcagatgaagctctgtgtccaaaacagccaccaggaagctcgaaacatgttacttcaaaatccacaactggcttatgcactgttgcaggcacaagtagtgatgagaatcatggatccagagattgctctgaaaattctgcatcggaagatacatgtcacaccactgatcccaggcaaatctcagtctgtgtctgtctctggccctggccctggccctggccctgggctctgcccaggacctaatgttctgctgaaccagcagaatcctccagctcctcagcctcagcatttggctagaagacctgtgaaggacattcctcctctgatgcagactcctatccagggtggaattccagctccagggccaataccagctgcagttcccggagctggtcctggttccttaactcctggaggagcaatgcagccccaacttggaatgccaggggttggcccagtgcctttagagcggggacaagtgcagatgtcagatcctagagctcctatacctcgcggacccgtgactcctggtggtctgcctcctcgaggactgttaggagatgctccaaatgacccacgtggagggactttgctttcagtcactggagaagtggagcccagaggttatctgggtccaccccatcagggtccccccatgcatcatgcctctggtcatgacactcgtggcccttcctcacatgagatgaggggagggccattaggagatcccagactgctaattggagagcccagaggccccatgatagatcaaaggggtctacctatggatggtagaggtggtagagattctcgagcgatggagactcgcgccatggaaactgaggtcttagagacacgtgtaatggagaggagaggaatggagacctgtgcgatggaaaccagagggatggaagcaaggggcatggatgcaagaggattggagatgaggggccctgtccccagttcaagaggccctatgactggtggaattcagggtcctggtcccattaatataggggcaggtggccctcctcagggacccagacaggtcccaggcatttcaggggtggggaatcctggagctggtatgcagggtacaggcatacaaggaacaggcatgcagggagcaggcatacaaggaggagggatgcagggggcaggcatacaaggagtcagtatacaaggaggaggtatacaaggaggaggtatacagggggcaagcaggcaaggtggaagccagcctagcagttttagtcctgggcagagccaggtcactccacaggatcaggagaaggcagctttgatcatgcaggttcttcaactgactgcagatcagattgccatgctgccccctgagcaaaggcagagtatcctgattttaaaggaacaaatccagaaatccactggagcgtcttga
Sequence Length
1851
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,437 Da
NCBI Official Full Name
Homo sapiens cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant, mRNA
NCBI Official Synonym Full Names
cleavage stimulation factor subunit 2 tau variant
NCBI Official Symbol
CSTF2T
NCBI Official Synonym Symbols
CstF-64T
NCBI Protein Information
cleavage stimulation factor subunit 2 tau variant
UniProt Protein Name
Cleavage stimulation factor subunit 2 tau variant
UniProt Gene Name
CSTF2T
UniProt Synonym Gene Names
KIAA0689; CSTF 64 kDa subunit tau variant
UniProt Entry Name
CSTFT_HUMAN

Uniprot Description

CstF-64T: May play a significant role in AAUAAA-independent mRNA polyadenylation in germ cells. Directly involved in the binding to pre-mRNAs.

Protein type: RNA-binding; RNA processing

Chromosomal Location of Human Ortholog: 10q11

Cellular Component: intracellular; mRNA cleavage and polyadenylation specificity factor complex

Molecular Function: mRNA binding; protein binding

Research Articles on CSTF2T

Similar Products

Product Notes

The CSTF2T cstf2t (Catalog #AAA1267036) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgagtt tggcggtgag agacccggca atggatcgat cactgcgttc cgtgttcgtg gggaacattc catatgaggc aactgaggag cagttaaagg acattttctc ggaggttggt tctgttgtca gtttccggct ggtatacgat agagagacgg gaaaacccaa gggctatggc ttctgcgaat accaagacca ggagaccgcg cttagtgcca tgcggaacct caatgggcgg gagttcagtg ggagagcgct tcgggtggac aatgctgcca gtgaaaagaa taaggaggag ttaaagagcc tcgggcctgc agcgcccatt attgactcac cctatgggga tcccatcgat ccagaagatg cccctgaatc gattaccaga gcagtagcca gtctcccccc ggagcagatg tttgagctga tgaagcagat gaagctctgt gtccaaaaca gccaccagga agctcgaaac atgttacttc aaaatccaca actggcttat gcactgttgc aggcacaagt agtgatgaga atcatggatc cagagattgc tctgaaaatt ctgcatcgga agatacatgt cacaccactg atcccaggca aatctcagtc tgtgtctgtc tctggccctg gccctggccc tggccctggg ctctgcccag gacctaatgt tctgctgaac cagcagaatc ctccagctcc tcagcctcag catttggcta gaagacctgt gaaggacatt cctcctctga tgcagactcc tatccagggt ggaattccag ctccagggcc aataccagct gcagttcccg gagctggtcc tggttcctta actcctggag gagcaatgca gccccaactt ggaatgccag gggttggccc agtgccttta gagcggggac aagtgcagat gtcagatcct agagctccta tacctcgcgg acccgtgact cctggtggtc tgcctcctcg aggactgtta ggagatgctc caaatgaccc acgtggaggg actttgcttt cagtcactgg agaagtggag cccagaggtt atctgggtcc accccatcag ggtcccccca tgcatcatgc ctctggtcat gacactcgtg gcccttcctc acatgagatg aggggagggc cattaggaga tcccagactg ctaattggag agcccagagg ccccatgata gatcaaaggg gtctacctat ggatggtaga ggtggtagag attctcgagc gatggagact cgcgccatgg aaactgaggt cttagagaca cgtgtaatgg agaggagagg aatggagacc tgtgcgatgg aaaccagagg gatggaagca aggggcatgg atgcaagagg attggagatg aggggccctg tccccagttc aagaggccct atgactggtg gaattcaggg tcctggtccc attaatatag gggcaggtgg ccctcctcag ggacccagac aggtcccagg catttcaggg gtggggaatc ctggagctgg tatgcagggt acaggcatac aaggaacagg catgcaggga gcaggcatac aaggaggagg gatgcagggg gcaggcatac aaggagtcag tatacaagga ggaggtatac aaggaggagg tatacagggg gcaagcaggc aaggtggaag ccagcctagc agttttagtc ctgggcagag ccaggtcact ccacaggatc aggagaaggc agctttgatc atgcaggttc ttcaactgac tgcagatcag attgccatgc tgccccctga gcaaaggcag agtatcctga ttttaaagga acaaatccag aaatccactg gagcgtcttg a. It is sometimes possible for the material contained within the vial of "CSTF2T, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.