Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CSNK2A1 cdna clone

CSNK2A1 cDNA Clone

Gene Names
CSNK2A1; CKII; CK2A1; OCNDS; CSNK2A3
Synonyms
CSNK2A1; CSNK2A1 cDNA Clone; CSNK2A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgggacccgtgccaagcagggccagagtttacacagatgttaatacacacagacctcgagaatactgggattacgagtcacatgtggtggaatggggaaatcaagatgactaccagctggttcgaaaattaggccgaggtaaatacagtgaagtatttgaagccatcaacatcacaaataatgaaaaagttgttgttaaaattctcaagccagtaaaaaagaagaaaattaagcgtgaaataaagattttggagaatttgagaggaggtcccaacatcatcacactggcagacattgtaaaagaccctgtgtcacgaacccccgccttggtttttgaacacgtaaacaacacagacttcaagcaattgtaccagacgttaacagactatgatattcgattttacatgtatgagattctgaaggccctggattattgtcacagcatgggaattatgcacagagatgtcaagccccataatgtcatgattgatcatgagcacagaaagctacgactaatagactggggtttggctgagttttatcatcctggccaagaatataatgtccgagttgcttcccgatacttcaaaggtcctgagctacttgtagactatcagatgtacgattatagtttggatatgtggagtttgggttgtatgctggcaagtatgatctttcggaaggagccatttttccatggacatgacaattatgatcagttggtgaggatagccaaggttctggggacagaagatttatatgactatattgacaaatacaacattgaattagatccacgtttcaatgatatcttgggcagacactctcgaaagcgatgggaacgctttgtccacagtgaaaatcagcaccttgtcagccctgaggccttggatttcctggacaaactgctgcgatatgaccaccagtcacggcttactgcaagagaggcaatggagcacccctatttctacactgttgtgaaggaccaggctcgaatgggttcatctagcatgccagggggcagtacgcccgtcagcagcgccaatatgatgtcagggatttcttcagtgccaaccccttcaccccttggacctctggcaggctcaccagtgattgctgctgccaacccccttgggatgcctgttccagctgccgctggcgctcagcagtaa
Sequence Length
1176
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,181 Da
NCBI Official Full Name
Homo sapiens casein kinase 2, alpha 1 polypeptide, mRNA
NCBI Official Synonym Full Names
casein kinase 2 alpha 1
NCBI Official Symbol
CSNK2A1
NCBI Official Synonym Symbols
CKII; CK2A1; OCNDS; CSNK2A3
NCBI Protein Information
casein kinase II subunit alpha
UniProt Protein Name
Casein kinase II subunit alpha
Protein Family
UniProt Gene Name
CSNK2A1
UniProt Synonym Gene Names
CK2A1; CK II alpha
UniProt Entry Name
CSK21_HUMAN

NCBI Description

Casein kinase II is a serine/threonine protein kinase that phosphorylates acidic proteins such as casein. It is involved in various cellular processes, including cell cycle control, apoptosis, and circadian rhythm. The kinase exists as a tetramer and is composed of an alpha, an alpha-prime, and two beta subunits. The alpha subunits contain the catalytic activity while the beta subunits undergo autophosphorylation. The protein encoded by this gene represents the alpha subunit. While this gene is found on chromosome 20, a related transcribed pseudogene is found on chromosome 11. Three transcript variants encoding two different proteins have been found for this gene. [provided by RefSeq, Jul 2014]

Uniprot Description

CK2A1: an ubiquitous protein kinase of the CK2 family. Exists as a tetramer composed of two catalytic subunits, alpha and alpha-prime, and two regulatory beta subunits. The beta subunits undergo autophosphorylation. The isoforms are rarely specified in publications. Two splice variant isoforms have been found. Participates in Wnt signaling. Phosphorylates E2 ubiquitin conjugating enzyme UBC3B inducing its interaction with beta-TRCp and enhancing beta-catenin degradation. May control IkB-alpha and p27Kip1 degradation. component of a CK2-SPT16-SSRP1 complex composed of SSRP1, PT16 CK2-A1, CK2-A2 and CK2-B the complex associating following UV irradiation. Interacts with RNPS1. Mouse transgene causes mammary gland hyperplasia and lymphoma, and activation by bovine parasites leads to fatal lymphoproliferation. Expression and activity are elevated in lung tumors and breast tumors. Antisense drives apoptosis of tumor cell lines and xenografts. Involved in DNA break repair by phosphorylation of scaffold protein XRCC1, phosphorylation of BRCA1, and phosphorylation of p53 in response to UV irradiation. Drosophila CK2 (Timekeeper) is involved in circadian regulation. Phosphorylates and binds to a major component of the inclusion bodies seen in Parkinson?s patients. Inhibitors: 4,5,6,7-tetrabromobenzotriazole (TBB).

Protein type: Protein kinase, Ser/Thr (non-receptor); Protein kinase, Other; Kinase, protein; EC 2.7.11.1; Other group; CK2 family

Chromosomal Location of Human Ortholog: 20p13

Cellular Component: cytosol; nucleoplasm; nucleus; NuRD complex; PcG protein complex; plasma membrane; Sin3 complex

Molecular Function: Hsp90 protein binding; protein binding; protein N-terminus binding; protein serine/threonine kinase activity

Biological Process: negative regulation of caspase activity; positive regulation of cell growth; positive regulation of cell proliferation; positive regulation of protein catabolic process; positive regulation of Wnt receptor signaling pathway; protein amino acid phosphorylation; protein folding; signal transduction

Research Articles on CSNK2A1

Similar Products

Product Notes

The CSNK2A1 csnk2a1 (Catalog #AAA1272426) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgggac ccgtgccaag cagggccaga gtttacacag atgttaatac acacagacct cgagaatact gggattacga gtcacatgtg gtggaatggg gaaatcaaga tgactaccag ctggttcgaa aattaggccg aggtaaatac agtgaagtat ttgaagccat caacatcaca aataatgaaa aagttgttgt taaaattctc aagccagtaa aaaagaagaa aattaagcgt gaaataaaga ttttggagaa tttgagagga ggtcccaaca tcatcacact ggcagacatt gtaaaagacc ctgtgtcacg aacccccgcc ttggtttttg aacacgtaaa caacacagac ttcaagcaat tgtaccagac gttaacagac tatgatattc gattttacat gtatgagatt ctgaaggccc tggattattg tcacagcatg ggaattatgc acagagatgt caagccccat aatgtcatga ttgatcatga gcacagaaag ctacgactaa tagactgggg tttggctgag ttttatcatc ctggccaaga atataatgtc cgagttgctt cccgatactt caaaggtcct gagctacttg tagactatca gatgtacgat tatagtttgg atatgtggag tttgggttgt atgctggcaa gtatgatctt tcggaaggag ccatttttcc atggacatga caattatgat cagttggtga ggatagccaa ggttctgggg acagaagatt tatatgacta tattgacaaa tacaacattg aattagatcc acgtttcaat gatatcttgg gcagacactc tcgaaagcga tgggaacgct ttgtccacag tgaaaatcag caccttgtca gccctgaggc cttggatttc ctggacaaac tgctgcgata tgaccaccag tcacggctta ctgcaagaga ggcaatggag cacccctatt tctacactgt tgtgaaggac caggctcgaa tgggttcatc tagcatgcca gggggcagta cgcccgtcag cagcgccaat atgatgtcag ggatttcttc agtgccaacc ccttcacccc ttggacctct ggcaggctca ccagtgattg ctgctgccaa cccccttggg atgcctgttc cagctgccgc tggcgctcag cagtaa. It is sometimes possible for the material contained within the vial of "CSNK2A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.