Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CSGALNACT1 cdna clone

CSGALNACT1 cDNA Clone

Gene Names
CSGALNACT1; ChGn; CSGalNAcT-1; beta4GalNAcT
Synonyms
CSGALNACT1; CSGALNACT1 cDNA Clone; CSGALNACT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgatggttcgccgggggctgcttgcgtggatttcccgggtggtggttttgctggtgctcctctgctgtgctatctctgtcctgtacatgttggcctgcaccccaaaaggtgacgaggagcagctggcactgcccagggccaacagccccacggggaaggaggggtaccaggccgtccttcaggagtgggaggagcagcaccgcaactacgtgagcagcctgaagcggcagatcgcacagctcaaggaggagctgcaggagaggagtgagcagctcaggaatgggcagtaccaagccagcgatgctgctggcctgggtctggacaggagccccccagagaaaacccaggccgacctcctggccttcctgcactcgcaggtggacaaggcagaggtgaatgctggcgtcaagctggccacagagtatgcagcagtgcctttcgatagctttactctacagaaggtgtaccagctggagactggccttacccgccaccccgaggagaagcctgtgaggaaggacaagcgggatgagttggtggaagccattgaatcagccttggagaccctgaacaatcctgcagagaacagccccaatcaccgtccttacacggcctctgatttcatagaagggatctaccgaacagaaagggacaaagggacattgtatgagctcaccttcaaaggggaccacaaacatgaattcaaacggctcatcttatttcgaccattcggccccatcatgaaagtggaaaatgaaaagctcaacatggccaacacgcttatcaatgttatcgtgcctctagcaaaaagggtggacaagttccggcagttcatgcagaatttcaggcctgctgatgaagtttttagatgtgtgcctttaagcccttga
Sequence Length
894
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,917 Da
NCBI Official Full Name
Homo sapiens chondroitin sulfate N-acetylgalactosaminyltransferase 1, mRNA
NCBI Official Synonym Full Names
chondroitin sulfate N-acetylgalactosaminyltransferase 1
NCBI Official Symbol
CSGALNACT1
NCBI Official Synonym Symbols
ChGn; CSGalNAcT-1; beta4GalNAcT
NCBI Protein Information
chondroitin sulfate N-acetylgalactosaminyltransferase 1
UniProt Protein Name
Chondroitin sulfate N-acetylgalactosaminyltransferase 1
UniProt Gene Name
CSGALNACT1
UniProt Synonym Gene Names
CHGN; GALNACT1; CsGalNAcT-1; Beta4GalNAcT-1
UniProt Entry Name
CGAT1_HUMAN

Uniprot Description

ChGn: Transfers 1,4-N-acetylgalactosamine (GalNAc) from UDP- GalNAc to the non-reducing end of glucuronic acid (GlcUA). Required for addition of the first GalNAc to the core tetrasaccharide linker and for elongation of chondroitin chains. Important role in chondroitin chain biosynthesis in cartilage. Belongs to the chondroitin N- acetylgalactosaminyltransferase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Glycan Metabolism - chondroitin sulfate biosynthesis; Membrane protein, integral; Transferase; EC 2.4.1.174

Chromosomal Location of Human Ortholog: 8p21.3

Cellular Component: Golgi membrane; intracellular

Molecular Function: acetylgalactosaminyltransferase activity; glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity; glucuronosyltransferase activity; glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity; peptidoglycan glycosyltransferase activity

Biological Process: chondroitin sulfate biosynthetic process; chondroitin sulfate proteoglycan biosynthetic process; chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process; dermatan sulfate proteoglycan biosynthetic process; proteoglycan biosynthetic process; UDP-glucuronate metabolic process; UDP-N-acetylgalactosamine metabolic process

Research Articles on CSGALNACT1

Similar Products

Product Notes

The CSGALNACT1 csgalnact1 (Catalog #AAA1272732) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgatgg ttcgccgggg gctgcttgcg tggatttccc gggtggtggt tttgctggtg ctcctctgct gtgctatctc tgtcctgtac atgttggcct gcaccccaaa aggtgacgag gagcagctgg cactgcccag ggccaacagc cccacgggga aggaggggta ccaggccgtc cttcaggagt gggaggagca gcaccgcaac tacgtgagca gcctgaagcg gcagatcgca cagctcaagg aggagctgca ggagaggagt gagcagctca ggaatgggca gtaccaagcc agcgatgctg ctggcctggg tctggacagg agccccccag agaaaaccca ggccgacctc ctggccttcc tgcactcgca ggtggacaag gcagaggtga atgctggcgt caagctggcc acagagtatg cagcagtgcc tttcgatagc tttactctac agaaggtgta ccagctggag actggcctta cccgccaccc cgaggagaag cctgtgagga aggacaagcg ggatgagttg gtggaagcca ttgaatcagc cttggagacc ctgaacaatc ctgcagagaa cagccccaat caccgtcctt acacggcctc tgatttcata gaagggatct accgaacaga aagggacaaa gggacattgt atgagctcac cttcaaaggg gaccacaaac atgaattcaa acggctcatc ttatttcgac cattcggccc catcatgaaa gtggaaaatg aaaagctcaa catggccaac acgcttatca atgttatcgt gcctctagca aaaagggtgg acaagttccg gcagttcatg cagaatttca ggcctgctga tgaagttttt agatgtgtgc ctttaagccc ttga. It is sometimes possible for the material contained within the vial of "CSGALNACT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.