Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CRP cdna clone

CRP cDNA Clone

Gene Names
CRP; PTX1
Synonyms
CRP; CRP cDNA Clone; CRP cdna clone
Ordering
For Research Use Only!
Sequence
atggagaagctgttgtgtttcttggtcttgaccagcctctctcatgcttttggccagacagacatgtcgaggaaggcttttgtgtttcccaaagagtcggatacttcctatgtatccctcaaagcaccgttaacgaagcctctcaaagccttcactgtgtgcctccacttctacacggaactgtcctcgacccgtggtcctaatgtcctgaactggcgggcactgaagtatgaagtgcaaggcgaagtgttcaccaaaccccagctgtggccctga
Sequence Length
276
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,415 Da
NCBI Official Full Name
Homo sapiens C-reactive protein, pentraxin-related, mRNA
NCBI Official Synonym Full Names
C-reactive protein
NCBI Official Symbol
CRP
NCBI Official Synonym Symbols
PTX1
NCBI Protein Information
C-reactive protein
UniProt Protein Name
C-reactive protein
Protein Family
UniProt Gene Name
CRP
UniProt Synonym Gene Names
PTX1
UniProt Entry Name
CRP_HUMAN

NCBI Description

The protein encoded by this gene belongs to the pentaxin family. It is involved in several host defense related functions based on its ability to recognize foreign pathogens and damaged cells of the host and to initiate their elimination by interacting with humoral and cellular effector systems in the blood. Consequently, the level of this protein in plasma increases greatly during acute phase response to tissue injury, infection, or other inflammatory stimuli. [provided by RefSeq, Sep 2009]

Uniprot Description

CRP: Displays several functions associated with host defense: it promotes agglutination, bacterial capsular swelling, phagocytosis and complement fixation through its calcium-dependent binding to phosphorylcholine. Can interact with DNA and histones and may scavenge nuclear material released from damaged circulating cells. Belongs to the pentaxin family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 1q23.2

Cellular Component: extracellular space

Molecular Function: calcium ion binding; choline binding; complement component C1q binding; low-density lipoprotein binding; low-density lipoprotein receptor binding; protein binding; virion binding

Biological Process: acute-phase response; defense response to Gram-positive bacterium; inflammatory response; negative regulation of vasodilation; opsonization; positive regulation of superoxide release

Research Articles on CRP

Similar Products

Product Notes

The CRP crp (Catalog #AAA1275295) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaagc tgttgtgttt cttggtcttg accagcctct ctcatgcttt tggccagaca gacatgtcga ggaaggcttt tgtgtttccc aaagagtcgg atacttccta tgtatccctc aaagcaccgt taacgaagcc tctcaaagcc ttcactgtgt gcctccactt ctacacggaa ctgtcctcga cccgtggtcc taatgtcctg aactggcggg cactgaagta tgaagtgcaa ggcgaagtgt tcaccaaacc ccagctgtgg ccctga. It is sometimes possible for the material contained within the vial of "CRP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.